BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 755e10 (312 letters) Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq 23,003 sequences; 15,818,664 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Rn.22740 EST220013 Rattus norvegicus cDNA, 3' end /clone... 78 2e-14 gnl|UG|Rn.2642 Rat peptidylarginine deiminase mRNA /cds=(60,205... 62 1e-09 gnl|UG|Rn.13721 EST202096 Rattus norvegicus cDNA, 3' end /clone... 56 6e-08 gnl|UG|Rn.17803 EST206551 Rattus norvegicus cDNA, 3' end /clone... 54 3e-07 gnl|UG|Rn.33751 EST211605 Rattus norvegicus cDNA, 3' end /clone... 54 3e-07 >gnl|UG|Rn.22740 EST220013 Rattus norvegicus cDNA, 3' end /clone=ROVBR63 /clone_end=3' /gb=AI176429 /gi=3727067 /len=552 Length = 552 Score = 77.8 bits (39), Expect = 2e-14 Identities = 57/63 (90%), Positives = 57/63 (90%) Query: 15 gctcttgcagaggacctggattcagttcccagcatccatgtggtggctcacgactatctg 74 |||||| ||||||||||| |||| ||||||||| ||||||||||||||||||| ||||| Sbjct: 149 gctcttccagaggacctgagttcaattcccagcaaccatgtggtggctcacgaccatctg 90 Query: 75 taa 77 ||| Sbjct: 89 taa 87 >gnl|UG|Rn.2642 Rat peptidylarginine deiminase mRNA /cds=(60,2057) /gb=J05022 /gi=205959 /len=4507 Length = 4507 Score = 61.9 bits (31), Expect = 1e-09 Identities = 52/59 (88%), Positives = 52/59 (88%) Query: 7 cacttgcagctcttgcagaggacctggattcagttcccagcatccatgtggtggctcac 65 ||||||| |||||||| |||||||||| |||||||| ||||| ||| ||||||||||| Sbjct: 3302 cacttgctgctcttgcggaggacctgggttcagttctcagcacccagttggtggctcac 3360 >gnl|UG|Rn.13721 EST202096 Rattus norvegicus cDNA, 3' end /clone=RBRAS65 /clone_end=3' /gb=AI007645 /gi=3221477 /len=553 Length = 553 Score = 56.0 bits (28), Expect = 6e-08 Identities = 55/64 (85%), Positives = 55/64 (85%) Query: 18 cttgcagaggacctggattcagttcccagcatccatgtggtggctcacgactatctgtaa 77 ||||||||| |||||| ||| ||||||| || ||| ||||||||||| ||| ||||||| Sbjct: 182 cttgcagagaacctgggttcggttcccaacacccacatggtggctcacaactgtctgtaa 123 Query: 78 ctct 81 |||| Sbjct: 122 ctct 119 >gnl|UG|Rn.17803 EST206551 Rattus norvegicus cDNA, 3' end /clone=RPLAS73 /clone_end=3' /gb=AI012100 /gi=3225932 /len=559 Length = 559 Score = 54.0 bits (27), Expect = 3e-07 Identities = 54/63 (85%), Positives = 54/63 (85%) Query: 15 gctcttgcagaggacctggattcagttcccagcatccatgtggtggctcacgactatctg 74 |||||| |||||| |||| |||| ||||||||| ||| ||||||||||| |||||||| Sbjct: 177 gctcttccagaggtcctgagttcaattcccagcaaccacatggtggctcacaactatctg 118 Query: 75 taa 77 ||| Sbjct: 117 taa 115 >gnl|UG|Rn.33751 EST211605 Rattus norvegicus cDNA, 3' end /clone=RBRCB96 /clone_end=3' /gb=AI102316 /gi=3707110 /len=494 Length = 494 Score = 54.0 bits (27), Expect = 3e-07 Identities = 54/63 (85%), Positives = 54/63 (85%) Query: 15 gctcttgcagaggacctggattcagttcccagcatccatgtggtggctcacgactatctg 74 |||||| |||||| |||| || | ||||||||| |||||||||||||||| || ||||| Sbjct: 136 gctcttccagaggtcctgagtttaattcccagcaaccatgtggtggctcacaaccatctg 77 Query: 75 taa 77 ||| Sbjct: 76 taa 74 Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq Posted date: Feb 19, 1999 3:28 AM Number of letters in database: 15,818,664 Number of sequences in database: 23,003 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2540 Number of Sequences: 23003 Number of extensions: 2540 Number of successful extensions: 854 Number of sequences better than 10: 138 length of query: 312 length of database: 15818664 effective HSP length: 16 effective length of query: 296 effective length of database: 15450616 effective search space: 4573382336 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)