BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 714b05 (350 letters) Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq 23,003 sequences; 15,818,664 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Rn.32940 UI-R-E1-gc-g-04-0-UI.s1 Rattus norvegicus cDNA,... 113 4e-25 gnl|UG|Rn.32463 UI-R-E0-by-a-08-0-UI.s4 Rattus norvegicus cDNA,... 96 8e-20 gnl|UG|Rn.21841 UI-R-Y0-lx-e-04-0-UI.s1 Rattus norvegicus cDNA,... 96 8e-20 gnl|UG|Rn.34394 EST213402 Rattus norvegicus cDNA, 3' end /clone... 92 1e-18 gnl|UG|Rn.33793 EST213799 Rattus norvegicus cDNA, 3' end /clone... 84 3e-16 >gnl|UG|Rn.32940 UI-R-E1-gc-g-04-0-UI.s1 Rattus norvegicus cDNA, 3' end /clone=UI-R-E1-gc-g-04-0-UI /clone_end=3' /gb=AA958004 /gi=3121699 /len=518 Length = 518 Score = 113 bits (57), Expect = 4e-25 Identities = 63/65 (96%), Positives = 63/65 (96%) Query: 271 ttaacttgagtatttcttatatacatttcgagtgttattccctttcctggtctccgggca 330 ||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| Sbjct: 16 ttaacttgagtatttcttatatacatttcgagtgttattccctttcccggtttccgggca 75 Query: 331 aacat 335 ||||| Sbjct: 76 aacat 80 >gnl|UG|Rn.32463 UI-R-E0-by-a-08-0-UI.s4 Rattus norvegicus cDNA, 3' end /clone=UI-R-E0-by-a-08-0-UI /clone_end=3' /gb=AA900605 /gi=3035959 /len=440 Length = 440 Score = 95.6 bits (48), Expect = 8e-20 Identities = 48/48 (100%), Positives = 48/48 (100%) Query: 270 attaacttgagtatttcttatatacatttcgagtgttattccctttcc 317 |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 15 attaacttgagtatttcttatatacatttcgagtgttattccctttcc 62 >gnl|UG|Rn.21841 UI-R-Y0-lx-e-04-0-UI.s1 Rattus norvegicus cDNA, 3' end /clone=UI-R-Y0-lx-e-04-0-UI /clone_end=3' /gb=AI073064 /gi=3399258 /len=363 Length = 363 Score = 95.6 bits (48), Expect = 8e-20 Identities = 60/64 (93%), Positives = 60/64 (93%) Query: 272 taacttgagtatttcttatatacatttcgagtgttattccctttcctggtctccgggcaa 331 ||||||||||||||||||| |||||||||| ||||||||||||||| ||| ||||||||| Sbjct: 20 taacttgagtatttcttatttacatttcgaatgttattccctttcccggtttccgggcaa 79 Query: 332 acat 335 |||| Sbjct: 80 acat 83 >gnl|UG|Rn.34394 EST213402 Rattus norvegicus cDNA, 3' end /clone=RHEBX45 /clone_end=3' /gb=AI104113 /gi=3708524 /len=463 Length = 463 Score = 91.7 bits (46), Expect = 1e-18 Identities = 61/66 (92%), Positives = 61/66 (92%) Query: 270 attaacttgagtatttcttatatacatttcgagtgttattccctttcctggtctccgggc 329 ||||||||||||||||||||| |||||||||| ||||||||||||||| ||| ||||||| Sbjct: 36 attaacttgagtatttcttatttacatttcgaatgttattccctttcccggtttccgggc 95 Query: 330 aaacat 335 ||||| Sbjct: 96 caacat 101 >gnl|UG|Rn.33793 EST213799 Rattus norvegicus cDNA, 3' end /clone=RHECE47 /clone_end=3' /gb=AI104510 /gi=3708854 /len=364 Length = 364 Score = 83.8 bits (42), Expect = 3e-16 Identities = 60/66 (90%), Positives = 60/66 (90%) Query: 270 attaacttgagtatttcttatatacatttcgagtgttattccctttcctggtctccgggc 329 ||||||||||||||||||||| |||||||| | ||||||||||||||| ||| || |||| Sbjct: 25 attaacttgagtatttcttatttacatttcaaatgttattccctttcccggtttctgggc 84 Query: 330 aaacat 335 |||||| Sbjct: 85 aaacat 90 Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq Posted date: Feb 19, 1999 3:28 AM Number of letters in database: 15,818,664 Number of sequences in database: 23,003 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2034 Number of Sequences: 23003 Number of extensions: 2034 Number of successful extensions: 583 Number of sequences better than 10: 30 length of query: 350 length of database: 15818664 effective HSP length: 16 effective length of query: 334 effective length of database: 15450616 effective search space: 5160505744 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)