BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 402c07 (395 letters) Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq 23,003 sequences; 15,818,664 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Rn.22963 Rattus norvegicus trp1 beta variant mRNA, compl... 107 2e-23 gnl|UG|Rn.33038 UI-R-C0-hj-c-03-0-UI.s1 Rattus norvegicus cDNA,... 92 1e-18 gnl|UG|Rn.34412 EST222551 Rattus norvegicus cDNA, 3' end /clone... 90 6e-18 gnl|UG|Rn.9263 EST218057 Rattus norvegicus cDNA, 3' end /clone=... 78 2e-14 gnl|UG|Rn.16461 UI-R-A0-am-a-08-0-UI.s1 Rattus norvegicus cDNA,... 78 2e-14 >gnl|UG|Rn.22963 Rattus norvegicus trp1 beta variant mRNA, complete cds /cds=(75,2354) /gb=AF061266 /gi=3786395 /len=4042 Length = 4042 Score = 107 bits (54), Expect = 2e-23 Identities = 75/82 (91%), Positives = 75/82 (91%) Query: 9 tcctggaactcactatgtagaccagactggccttgaactcagagacctgcctgcctctgt 68 ||||||||| |||| |||||||||| ||| ||||||||||||||| ||||||||||||| Sbjct: 2970 tcctggaacccactctgtagaccaggctgaccttgaactcagagatctgcctgcctctgc 2911 Query: 69 ctcccgagtactgggattaaag 90 ||||||||| |||||||||||| Sbjct: 2910 ctcccgagtgctgggattaaag 2889 >gnl|UG|Rn.33038 UI-R-C0-hj-c-03-0-UI.s1 Rattus norvegicus cDNA, 3' end /clone=UI-R-C0-hj-c-03-0-UI /clone_end=3' /gb=AA996641 /gi=3187196 /len=327 Length = 327 Score = 91.7 bits (46), Expect = 1e-18 Identities = 67/74 (90%), Positives = 67/74 (90%) Query: 11 ctggaactcactatgtagaccagactggccttgaactcagagacctgcctgcctctgtct 70 |||||||||||| |||||||||||||||||||||||||| ||| ||||||||||||| || Sbjct: 209 ctggaactcactctgtagaccagactggccttgaactcaaagatctgcctgcctctgcct 268 Query: 71 cccgagtactggga 84 | |||| |||||| Sbjct: 269 ctggagtgctggga 282 >gnl|UG|Rn.34412 EST222551 Rattus norvegicus cDNA, 3' end /clone=RSPBQ46 /clone_end=3' /gb=AI178869 /gi=3729507 /len=408 Length = 408 Score = 89.7 bits (45), Expect = 6e-18 Identities = 72/81 (88%), Positives = 72/81 (88%) Query: 10 cctggaactcactatgtagaccagactggccttgaactcagagacctgcctgcctctgtc 69 ||||||||||||| |||||||||| ||||||||||||||||||| || ||||||||| Sbjct: 38 cctggaactcactgtgtagaccaggctggccttgaactcagagatgcacccgcctctgtc 97 Query: 70 tcccgagtactgggattaaag 90 ||| |||| |||||||||||| Sbjct: 98 tcctgagtgctgggattaaag 118 >gnl|UG|Rn.9263 EST218057 Rattus norvegicus cDNA, 3' end /clone=RMUBU45 /clone_end=3' /gb=AI172062 /gi=3712102 /len=495 Length = 495 Score = 77.8 bits (39), Expect = 2e-14 Identities = 57/63 (90%), Positives = 57/63 (90%) Query: 7 tgtcctggaactcactatgtagaccagactggccttgaactcagagacctgcctgcctct 66 |||||||||||| || |||||||||| ||||||||||||||||||| |||||||||| | Sbjct: 77 tgtcctggaacttgctctgtagaccaggctggccttgaactcagagatctgcctgccttt 136 Query: 67 gtc 69 ||| Sbjct: 137 gtc 139 >gnl|UG|Rn.16461 UI-R-A0-am-a-08-0-UI.s1 Rattus norvegicus cDNA, 3' end /clone=UI-R-A0-am-a-08-0-UI /clone_end=3' /gb=AA818139 /gi=2888019 /len=518 Length = 518 Score = 77.8 bits (39), Expect = 2e-14 Identities = 72/82 (87%), Positives = 72/82 (87%), Gaps = 2/82 (2%) Query: 11 ctggaactcactatgtagaccagactggccttgaa--ctcagagacctgcctgcctctgt 68 |||||||||||| |||||||||| ||||||||||| |||||||| | || ||||||| Sbjct: 422 ctggaactcactctgtagaccagtctggccttgaactctcagagatccgcttgcctcttc 363 Query: 69 ctcccgagtactgggattaaag 90 ||||| |||||||||||||||| Sbjct: 362 ctcccaagtactgggattaaag 341 Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq Posted date: Feb 19, 1999 3:28 AM Number of letters in database: 15,818,664 Number of sequences in database: 23,003 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3866 Number of Sequences: 23003 Number of extensions: 3866 Number of successful extensions: 1480 Number of sequences better than 10: 367 length of query: 395 length of database: 15818664 effective HSP length: 16 effective length of query: 379 effective length of database: 15450616 effective search space: 5855783464 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)