BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 110d12 (448 letters) Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq 23,003 sequences; 15,818,664 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Rn.18139 UI-R-C0-il-b-08-0-UI.s1 Rattus norvegicus cDNA,... 167 4e-41 gnl|UG|Rn.24816 EST234403 Rattus norvegicus cDNA, 3' end /clone... 32 1.3 >gnl|UG|Rn.18139 UI-R-C0-il-b-08-0-UI.s1 Rattus norvegicus cDNA, 3' end /clone=UI-R-C0-il-b-08-0-UI /clone_end=3' /gb=AI029070 /gi=3246896 /len=358 Length = 358 Score = 167 bits (84), Expect = 4e-41 Identities = 84/84 (100%), Positives = 84/84 (100%) Query: 1 aattgtacatactctaagtgatgtagttttgaccggttttatttggttgacatgatttta 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 100 aattgtacatactctaagtgatgtagttttgaccggttttatttggttgacatgatttta 41 Query: 61 tattaaaagagaatgctgctttca 84 |||||||||||||||||||||||| Sbjct: 40 tattaaaagagaatgctgctttca 17 >gnl|UG|Rn.24816 EST234403 Rattus norvegicus cDNA, 3' end /clone=RPLDG67 /clone_end=3' /gb=AI237841 /gi=3831347 /len=376 Length = 376 Score = 32.2 bits (16), Expect = 1.3 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 286 accacagcagctgtct 301 |||||||||||||||| Sbjct: 236 accacagcagctgtct 251 Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq Posted date: Feb 19, 1999 3:28 AM Number of letters in database: 15,818,664 Number of sequences in database: 23,003 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3764 Number of Sequences: 23003 Number of extensions: 3764 Number of successful extensions: 1039 Number of sequences better than 10: 8 length of query: 448 length of database: 15818664 effective HSP length: 17 effective length of query: 431 effective length of database: 15427613 effective search space: 6649301203 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)