BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 067h03 (334 letters) Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq 23,003 sequences; 15,818,664 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Rn.17202 EST192576 Rattus norvegicus cDNA, 3' end /clone... 72 1e-12 gnl|UG|Rn.6050 Rattus norvegicus Fc gamma receptor RIIIH isofor... 44 3e-04 gnl|UG|Rn.9798 Rat mRNA for phospholipase D, complete cds /cds=... 44 3e-04 gnl|UG|Rn.32692 UI-R-A1-ec-g-04-0-UI.s1 Rattus norvegicus cDNA,... 42 0.001 gnl|UG|Rn.22447 EST212769 Rattus norvegicus cDNA, 3' end /clone... 40 0.004 >gnl|UG|Rn.17202 EST192576 Rattus norvegicus cDNA, 3' end /clone=RMUAJ20 /clone_end=3' /gb=AA849809 /gi=2937349 /len=350 Length = 350 Score = 71.9 bits (36), Expect = 1e-12 Identities = 36/36 (100%), Positives = 36/36 (100%) Query: 299 agttggaaaaatactatttgaaaaacagcccagatc 334 |||||||||||||||||||||||||||||||||||| Sbjct: 350 agttggaaaaatactatttgaaaaacagcccagatc 315 >gnl|UG|Rn.6050 Rattus norvegicus Fc gamma receptor RIIIH isoform mRNA, complete cds /cds=(236,1039) /gb=L08446 /gi=204120 /len=1424 Length = 1424 Score = 44.1 bits (22), Expect = 3e-04 Identities = 22/22 (100%), Positives = 22/22 (100%) Query: 40 aagttgtcctctgacctccaca 61 |||||||||||||||||||||| Sbjct: 1362 aagttgtcctctgacctccaca 1383 >gnl|UG|Rn.9798 Rat mRNA for phospholipase D, complete cds /cds=(336,3137) /gb=D88672 /gi=2077942 /len=4562 Length = 4562 Score = 44.1 bits (22), Expect = 3e-04 Identities = 22/22 (100%), Positives = 22/22 (100%) Query: 40 aagttgtcctctgacctccaca 61 |||||||||||||||||||||| Sbjct: 4477 aagttgtcctctgacctccaca 4498 >gnl|UG|Rn.32692 UI-R-A1-ec-g-04-0-UI.s1 Rattus norvegicus cDNA, 3' end /clone=UI-R-A1-ec-g-04-0-UI /clone_end=3' /gb=AA925727 /gi=3072863 /len=275 Length = 275 Score = 42.1 bits (21), Expect = 0.001 Identities = 21/21 (100%), Positives = 21/21 (100%) Query: 39 caagttgtcctctgacctcca 59 ||||||||||||||||||||| Sbjct: 245 caagttgtcctctgacctcca 265 >gnl|UG|Rn.22447 EST212769 Rattus norvegicus cDNA, 3' end /clone=REMCC53 /clone_end=3' /gb=AI103480 /gi=3708019 /len=451 Length = 451 Score = 40.1 bits (20), Expect = 0.004 Identities = 20/20 (100%), Positives = 20/20 (100%) Query: 41 agttgtcctctgacctccac 60 |||||||||||||||||||| Sbjct: 176 agttgtcctctgacctccac 157 Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq Posted date: Feb 19, 1999 3:28 AM Number of letters in database: 15,818,664 Number of sequences in database: 23,003 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2251 Number of Sequences: 23003 Number of extensions: 2251 Number of successful extensions: 655 Number of sequences better than 10: 57 length of query: 334 length of database: 15818664 effective HSP length: 16 effective length of query: 318 effective length of database: 15450616 effective search space: 4913295888 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)