BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 01433 (331 letters) Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq 23,003 sequences; 15,818,664 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Rn.22536 UI-R-C1-kj-a-12-0-UI.s1 Rattus norvegicus cDNA,... 66 7e-11 gnl|UG|Rn.24762 EST230574 Rattus norvegicus cDNA, 3' end /clone... 50 4e-06 gnl|UG|Rn.29051 EST220531 Rattus norvegicus cDNA, 3' end /clone... 48 2e-05 gnl|UG|Rn.33508 UI-R-Y0-lw-g-12-0-UI.s1 Rattus norvegicus cDNA,... 46 7e-05 gnl|UG|Rn.25230 EST220461 Rattus norvegicus cDNA, 3' end /clone... 44 3e-04 >gnl|UG|Rn.22536 UI-R-C1-kj-a-12-0-UI.s1 Rattus norvegicus cDNA, 3' end /clone=UI-R-C1-kj-a-12-0-UI /clone_end=3' /gb=AI045480 /gi=3292299 /len=495 Length = 495 Score = 65.9 bits (33), Expect = 7e-11 Identities = 36/37 (97%), Positives = 36/37 (97%) Query: 295 tttaatcccagcacttagaggcagaggcaagtggatc 331 |||||||||||||||| |||||||||||||||||||| Sbjct: 390 tttaatcccagcactttgaggcagaggcaagtggatc 426 >gnl|UG|Rn.24762 EST230574 Rattus norvegicus cDNA, 3' end /clone=RLUCS35 /clone_end=3' /gb=AI233886 /gi=3817766 /len=591 Length = 591 Score = 50.1 bits (25), Expect = 4e-06 Identities = 37/41 (90%), Positives = 37/41 (90%) Query: 283 gtggtgtacacttttaatcccagcacttagaggcagaggca 323 |||||| |||| ||||||||||| ||| ||||||||||||| Sbjct: 467 gtggtgcacacctttaatcccagaactcagaggcagaggca 427 >gnl|UG|Rn.29051 EST220531 Rattus norvegicus cDNA, 3' end /clone=ROVBY64 /clone_end=3' /gb=AI176925 /gi=3727563 /len=398 Length = 398 Score = 48.1 bits (24), Expect = 2e-05 Identities = 34/36 (94%), Positives = 34/36 (94%), Gaps = 1/36 (2%) Query: 284 tggtgtacacttttaatcccagcactt-agaggcag 318 ||||||||||||||||||||||| ||| |||||||| Sbjct: 3 tggtgtacacttttaatcccagcccttgagaggcag 38 >gnl|UG|Rn.33508 UI-R-Y0-lw-g-12-0-UI.s1 Rattus norvegicus cDNA, 3' end /clone=UI-R-Y0-lw-g-12-0-UI /clone_end=3' /gb=AI072851 /gi=3399045 /len=316 Length = 316 Score = 46.1 bits (23), Expect = 7e-05 Identities = 39/43 (90%), Positives = 39/43 (90%), Gaps = 1/43 (2%) Query: 290 acacttttaatcccagcactt-agaggcagaggcaagtggatc 331 |||| |||||||||||||||| |||||||||||| ||||||| Sbjct: 138 acacctttaatcccagcacttgggaggcagaggcaggtggatc 180 >gnl|UG|Rn.25230 EST220461 Rattus norvegicus cDNA, 3' end /clone=ROVBX76 /clone_end=3' /gb=AI176858 /gi=3727496 /len=719 Length = 719 Score = 44.1 bits (22), Expect = 3e-04 Identities = 35/38 (92%), Positives = 35/38 (92%), Gaps = 1/38 (2%) Query: 295 tttaatcccagcacttag-aggcagaggcaagtggatc 331 |||||||||||||| | | ||||||||||||||||||| Sbjct: 78 tttaatcccagcacatgggaggcagaggcaagtggatc 115 Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq Posted date: Feb 19, 1999 3:28 AM Number of letters in database: 15,818,664 Number of sequences in database: 23,003 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2990 Number of Sequences: 23003 Number of extensions: 2990 Number of successful extensions: 1009 Number of sequences better than 10: 141 length of query: 331 length of database: 15818664 effective HSP length: 16 effective length of query: 315 effective length of database: 15450616 effective search space: 4866944040 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)