BLASTN 2.0.5 [May-5-1998]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= D12Rat14
         (865 letters)

Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq
           23,003 sequences; 15,818,664 total letters

Searching..................................................done

                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

gnl|UG|Rn.20139 UI-R-C2-ng-h-05-0-UI.s1 Rattus norvegicus cDNA,...    98  5e-20
gnl|UG|Rn.12103 UI-R-E0-dk-e-02-0-UI.s1 Rattus norvegicus cDNA,...    66  2e-10
gnl|UG|Rn.9961 Rat transferrin receptor mRNA, 3' end /cds=(0,18...    54  7e-07
gnl|UG|Rn.34381 UI-R-C1-jw-a-09-0-UI.s1 Rattus norvegicus cDNA,...    52  3e-06
gnl|UG|Rn.6332 Rattus norvegicus prostaglandin F2a receptor reg...    36  0.17

>gnl|UG|Rn.20139 UI-R-C2-ng-h-05-0-UI.s1 Rattus norvegicus cDNA, 3'
           end /clone=UI-R-C2-ng-h-05-0-UI /clone_end=3'
           /gb=AI072372 /gi=3398566 /len=378
           Length = 378
           
 Score = 97.6 bits (49), Expect = 5e-20
 Identities = 82/93 (88%), Positives = 82/93 (88%)

                                                                       
Query: 49  agaattctcaactgaggaatattgaatggctgagaagcacctaaggaaatgttcaacatc 108
           |||||||||||| ||||||| || |||||||||||||||  ||| |||||||||||  ||
Sbjct: 20  agaattctcaacagaggaatctttaatggctgagaagcatgtaaagaaatgttcaatgtc 79

                                            
Query: 109 cttagtcattagggaaatgcaaatcaaaacaac 141
           ||||||||| | ||||||| |||||||||||||
Sbjct: 80  cttagtcatcaaggaaatgaaaatcaaaacaac 112


 Score = 32.2 bits (16), Expect = 2.6
 Identities = 19/20 (95%), Positives = 19/20 (95%)

                               
Query: 238 ccattgctggtgggattgca 257
           ||||||||||||||| ||||
Sbjct: 210 ccattgctggtgggagtgca 229


>gnl|UG|Rn.12103 UI-R-E0-dk-e-02-0-UI.s1 Rattus norvegicus cDNA, 3'
           end /clone=UI-R-E0-dk-e-02-0-UI /clone_end=3'
           /gb=AA900802 /gi=3036156 /len=476
           Length = 476
           
 Score = 65.9 bits (33), Expect = 2e-10
 Identities = 36/37 (97%), Positives = 36/37 (97%)

                                                
Query: 227 ggaacactcctccattgctggtgggattgcagactgg 263
           ||||||||||||||||| |||||||||||||||||||
Sbjct: 171 ggaacactcctccattgttggtgggattgcagactgg 135


>gnl|UG|Rn.9961 Rat transferrin receptor mRNA, 3' end /cds=(0,1869)
            /gb=M58040 /gi=207463 /len=3413
            Length = 3413
            
 Score = 54.0 bits (27), Expect = 7e-07
 Identities = 29/30 (96%), Positives = 29/30 (96%)

                                          
Query: 1    atgccngcaggtcgactctagaggatcccc 30
            ||||| ||||||||||||||||||||||||
Sbjct: 2713 atgcctgcaggtcgactctagaggatcccc 2742


 Score = 54.0 bits (27), Expect = 7e-07
 Identities = 29/30 (96%), Positives = 29/30 (96%)

                                          
Query: 1    atgccngcaggtcgactctagaggatcccc 30
            ||||| ||||||||||||||||||||||||
Sbjct: 2672 atgcctgcaggtcgactctagaggatcccc 2643


>gnl|UG|Rn.34381 UI-R-C1-jw-a-09-0-UI.s1 Rattus norvegicus cDNA, 3'
           end /clone=UI-R-C1-jw-a-09-0-UI /clone_end=3'
           /gb=AI044421 /gi=3291324 /len=280
           Length = 280
           
 Score = 52.0 bits (26), Expect = 3e-06
 Identities = 44/50 (88%), Positives = 44/50 (88%)

                                                             
Query: 192 gtgacagcagatgctggcgaggatgtggagaaagaggaacactcctccat 241
           ||||||||  ||||||| ||||||||||||| || ||||||||| |||||
Sbjct: 83  gtgacagcccatgctggtgaggatgtggagagaggggaacactcatccat 34


>gnl|UG|Rn.6332 Rattus norvegicus prostaglandin F2a receptor
            regulatory protein precursor, mRNA, complete cds
            /cds=(46,2685) /gb=U26595 /gi=1054883 /len=5825
            Length = 5825
            
 Score = 36.2 bits (18), Expect = 0.17
 Identities = 18/18 (100%), Positives = 18/18 (100%)

                              
Query: 35   agctaaaaaagaaaagaa 52
            ||||||||||||||||||
Sbjct: 5527 agctaaaaaagaaaagaa 5510


  Database: /ddhome/DDsys/GenDB/UniGeneRn/Rn.seq.uniq
    Posted date:  Feb 19, 1999  3:28 AM
  Number of letters in database: 15,818,664
  Number of sequences in database:  23,003
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5489
Number of Sequences: 23003
Number of extensions: 5489
Number of successful extensions: 490
Number of sequences better than 10: 19
length of query: 865
length of database: 15818664
effective HSP length: 17
effective length of query: 848
effective length of database: 15427613
effective search space: 13082615824
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 25 (49.6 bits)
S1: 0 ( 0.5 bits)
S2: 16 (32.2 bits)