BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 978a10 (398 letters) Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq 15,275 sequences; 15,836,343 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Mm.26731 ud68f05.x1 Mus musculus cDNA, 3' end /clone=IMA... 78 2e-14 gnl|UG|Mm.25872 AU045052 Mus musculus cDNA, 3' end /clone=J0929... 52 1e-06 gnl|UG|Mm.20896 Mus musculus Inv mRNA, complete cds /cds=(182,3... 36 0.077 gnl|UG|Mm.29281 me67f05.y1 Mus musculus cDNA, 5' end /clone=IMA... 32 1.2 gnl|UG|Mm.4838 Prostaglandin I receptor (IP) /cds=(280,1533) /g... 32 1.2 >gnl|UG|Mm.26731 ud68f05.x1 Mus musculus cDNA, 3' end /clone=IMAGE:1451073 /clone_end=3' /gb=AI182371 /gi=3733009 /len=786 Length = 786 Score = 77.8 bits (39), Expect = 2e-14 Identities = 60/67 (89%), Positives = 60/67 (89%) Query: 5 cccttaatggtctatcttgtctggcctcagtggaagaggatgtgcctagtcctgcagtga 64 |||| |||||||| ||||||||||||||||||||||||||| ||||||||||||| | Sbjct: 226 ccctaaatggtctgccttgtctggcctcagtggaagaggatgaacctagtcctgcagggg 167 Query: 65 cttgatg 71 ||||||| Sbjct: 166 cttgatg 160 >gnl|UG|Mm.25872 AU045052 Mus musculus cDNA, 3' end /clone=J0929C07 /clone_end=3' /gb=AU045052 /gi=3981235 /len=432 Length = 432 Score = 52.0 bits (26), Expect = 1e-06 Identities = 32/34 (94%), Positives = 32/34 (94%) Query: 20 cttgtctggcctcagtggaagaggatgtgcctag 53 ||||||||| |||||||| ||||||||||||||| Sbjct: 207 cttgtctggactcagtgggagaggatgtgcctag 174 >gnl|UG|Mm.20896 Mus musculus Inv mRNA, complete cds /cds=(182,3370) /gb=AF034860 /gi=3560522 /len=5650 Length = 5650 Score = 36.2 bits (18), Expect = 0.077 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 20 cttgtctggcctcagtgg 37 |||||||||||||||||| Sbjct: 4947 cttgtctggcctcagtgg 4964 >gnl|UG|Mm.29281 me67f05.y1 Mus musculus cDNA, 5' end /clone=IMAGE:400641 /clone_end=5' /gb=AI425717 /len=625 Length = 625 Score = 32.2 bits (16), Expect = 1.2 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 36 ggaagaggatgtgcct 51 |||||||||||||||| Sbjct: 140 ggaagaggatgtgcct 125 >gnl|UG|Mm.4838 Prostaglandin I receptor (IP) /cds=(280,1533) /gb=D26157 /gi=493687 /len=3289 Length = 3289 Score = 32.2 bits (16), Expect = 1.2 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 29 cctcagtggaagagga 44 |||||||||||||||| Sbjct: 1904 cctcagtggaagagga 1889 Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq Posted date: Feb 17, 1999 1:37 AM Number of letters in database: 15,836,343 Number of sequences in database: 15,275 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1208 Number of Sequences: 15275 Number of extensions: 1208 Number of successful extensions: 295 Number of sequences better than 10: 8 length of query: 398 length of database: 15836343 effective HSP length: 16 effective length of query: 382 effective length of database: 15591943 effective search space: 5956122226 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)