BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 962d04 (227 letters) Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq 15,275 sequences; 15,836,343 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Mm.11678 uj14g04.x1 Mus musculus cDNA, 3' end /clone=IMA... 62 7e-10 gnl|UG|Mm.17645 AU042139 Mus musculus cDNA, 3' end /clone=J1014... 42 7e-04 gnl|UG|Mm.26087 AU018075 Mus musculus cDNA, 3' end /clone=J0748... 42 7e-04 gnl|UG|Mm.23100 mc69h05.x1 Mus musculus cDNA, 3' end /clone=IMA... 40 0.003 gnl|UG|Mm.26829 AU042166 Mus musculus cDNA, 3' end /clone=J1014... 40 0.003 >gnl|UG|Mm.11678 uj14g04.x1 Mus musculus cDNA, 3' end /clone=IMAGE:1908054 /clone_end=3' /gb=AI316512 /len=532 Length = 532 Score = 61.9 bits (31), Expect = 7e-10 Identities = 52/59 (88%), Positives = 52/59 (88%) Query: 157 atttatttattatgtatacattattttgccggcatgtatacctacatgccagaagaggg 215 |||||||||||||||||||| | || |||| |||||||| ||| || |||||||||||| Sbjct: 22 atttatttattatgtatacagtgttctgcctgcatgtatgcctgcaggccagaagaggg 80 >gnl|UG|Mm.17645 AU042139 Mus musculus cDNA, 3' end /clone=J1014D04 /clone_end=3' /gb=AU042139 /gi=3956374 /len=588 Length = 588 Score = 42.1 bits (21), Expect = 7e-04 Identities = 24/25 (96%), Positives = 24/25 (96%) Query: 200 acatgccagaagagggcatcagatc 224 |||| |||||||||||||||||||| Sbjct: 49 acattccagaagagggcatcagatc 73 >gnl|UG|Mm.26087 AU018075 Mus musculus cDNA, 3' end /clone=J0748E05 /clone_end=3' /gb=AU018075 /gi=3373565 /len=457 Length = 457 Score = 42.1 bits (21), Expect = 7e-04 Identities = 21/21 (100%), Positives = 21/21 (100%) Query: 204 gccagaagagggcatcagatc 224 ||||||||||||||||||||| Sbjct: 55 gccagaagagggcatcagatc 75 >gnl|UG|Mm.23100 mc69h05.x1 Mus musculus cDNA, 3' end /clone=IMAGE:353817 /clone_end=3' /gb=AI415688 /len=457 Length = 457 Score = 40.1 bits (20), Expect = 0.003 Identities = 20/20 (100%), Positives = 20/20 (100%) Query: 205 ccagaagagggcatcagatc 224 |||||||||||||||||||| Sbjct: 71 ccagaagagggcatcagatc 90 >gnl|UG|Mm.26829 AU042166 Mus musculus cDNA, 3' end /clone=J1014G07 /clone_end=3' /gb=AU042166 /gi=3956401 /len=352 Length = 352 Score = 40.1 bits (20), Expect = 0.003 Identities = 20/20 (100%), Positives = 20/20 (100%) Query: 205 ccagaagagggcatcagatc 224 |||||||||||||||||||| Sbjct: 51 ccagaagagggcatcagatc 70 Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq Posted date: Feb 17, 1999 1:37 AM Number of letters in database: 15,836,343 Number of sequences in database: 15,275 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2082 Number of Sequences: 15275 Number of extensions: 2082 Number of successful extensions: 712 Number of sequences better than 10: 136 length of query: 227 length of database: 15836343 effective HSP length: 16 effective length of query: 211 effective length of database: 15591943 effective search space: 3289899973 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)