BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 958h01 (408 letters) Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq 15,275 sequences; 15,836,343 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Mm.19006 C77646 Mus musculus cDNA, 3' end /clone=J0035D0... 46 8e-05 gnl|UG|Mm.19255 AU046204 Mus musculus cDNA, 3' end /clone=J0948... 44 3e-04 gnl|UG|Mm.11188 AU041986 Mus musculus cDNA, 3' end /clone=J1012... 44 3e-04 gnl|UG|Mm.28689 mq37b05.r1 Mus musculus cDNA, 5' end /clone=IMA... 36 0.079 gnl|UG|Mm.27264 MMGEG060 Mus musculus cDNA /clone=GEG-60 /gb=X7... 36 0.079 >gnl|UG|Mm.19006 C77646 Mus musculus cDNA, 3' end /clone=J0035D05 /clone_end=3' /gb=C77646 /gi=2517976 /len=618 Length = 618 Score = 46.1 bits (23), Expect = 8e-05 Identities = 29/31 (93%), Positives = 29/31 (93%) Query: 209 gactcatatcccacgcaggggcacaggagtt 239 ||||||||||||||||||||| | ||||||| Sbjct: 47 gactcatatcccacgcaggggtagaggagtt 77 >gnl|UG|Mm.19255 AU046204 Mus musculus cDNA, 3' end /clone=J0948D11 /clone_end=3' /gb=AU046204 /gi=3982387 /len=337 Length = 337 Score = 44.1 bits (22), Expect = 3e-04 Identities = 28/30 (93%), Positives = 28/30 (93%) Query: 209 gactcatatcccacgcaggggcacaggagt 238 ||||||||||||||||||||| | |||||| Sbjct: 48 gactcatatcccacgcaggggtagaggagt 77 >gnl|UG|Mm.11188 AU041986 Mus musculus cDNA, 3' end /clone=J1012B04 /clone_end=3' /gb=AU041986 /gi=3956221 /len=587 Length = 587 Score = 44.1 bits (22), Expect = 3e-04 Identities = 28/30 (93%), Positives = 28/30 (93%) Query: 209 gactcatatcccacgcaggggcacaggagt 238 ||||||||||||||||||||| | |||||| Sbjct: 48 gactcatatcccacgcaggggtagaggagt 77 >gnl|UG|Mm.28689 mq37b05.r1 Mus musculus cDNA, 5' end /clone=IMAGE:580881 /clone_end=5' /gb=AA139903 /gi=1702107 /len=703 Length = 703 Score = 36.2 bits (18), Expect = 0.079 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 8 tgcccttttctttcttct 25 |||||||||||||||||| Sbjct: 33 tgcccttttctttcttct 16 >gnl|UG|Mm.27264 MMGEG060 Mus musculus cDNA /clone=GEG-60 /gb=X71649 /gi=297502 /len=333 Length = 333 Score = 36.2 bits (18), Expect = 0.079 Identities = 27/30 (90%), Positives = 27/30 (90%) Query: 209 gactcatatcccacgcaggggcacaggagt 238 ||||||||||||| ||||||| | |||||| Sbjct: 68 gactcatatcccatgcaggggaagaggagt 39 Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq Posted date: Feb 17, 1999 1:37 AM Number of letters in database: 15,836,343 Number of sequences in database: 15,275 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3548 Number of Sequences: 15275 Number of extensions: 3548 Number of successful extensions: 1057 Number of sequences better than 10: 38 length of query: 408 length of database: 15836343 effective HSP length: 16 effective length of query: 392 effective length of database: 15591943 effective search space: 6112041656 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)