BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 950d04 (272 letters) Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq 15,275 sequences; 15,836,343 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Mm.23953 ud63g03.x1 Mus musculus cDNA, 3' end /clone=IMA... 34 0.20 gnl|UG|Mm.179 Early B-cell factor 2 /cds=(374,2101) /gb=U92703 ... 34 0.20 gnl|UG|Mm.30168 uc81f02.x1 Mus musculus cDNA, 3' end /clone=IMA... 34 0.20 gnl|UG|Mm.5126 Fas-associating protein with death domain /cds=(... 32 0.80 gnl|UG|Mm.12931 Mus musculus mRNA for RNA binding protein /cds=... 32 0.80 >gnl|UG|Mm.23953 ud63g03.x1 Mus musculus cDNA, 3' end /clone=IMAGE:1450612 /clone_end=3' /gb=AI174017 /gi=3720159 /len=737 Length = 737 Score = 34.2 bits (17), Expect = 0.20 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 253 atgtgaagctgctgatc 269 ||||||||||||||||| Sbjct: 177 atgtgaagctgctgatc 193 >gnl|UG|Mm.179 Early B-cell factor 2 /cds=(374,2101) /gb=U92703 /gi=2114429 /len=3747 Length = 3747 Score = 34.2 bits (17), Expect = 0.20 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 82 ggcatggaggcaggaag 98 ||||||||||||||||| Sbjct: 3237 ggcatggaggcaggaag 3253 >gnl|UG|Mm.30168 uc81f02.x1 Mus musculus cDNA, 3' end /clone=IMAGE:1432059 /clone_end=3' /gb=AA986095 /gi=3167970 /len=810 Length = 810 Score = 34.2 bits (17), Expect = 0.20 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 32 aagcctttgcttctgcc 48 ||||||||||||||||| Sbjct: 187 aagcctttgcttctgcc 203 >gnl|UG|Mm.5126 Fas-associating protein with death domain /cds=(12,629) /gb=U50406 /gi=1236699 /len=1377 Length = 1377 Score = 32.2 bits (16), Expect = 0.80 Identities = 19/20 (95%), Positives = 19/20 (95%) Query: 92 caggaaggggtccatgggta 111 |||||| ||||||||||||| Sbjct: 27 caggaatgggtccatgggta 8 >gnl|UG|Mm.12931 Mus musculus mRNA for RNA binding protein /cds=(0,2246) /gb=AJ006486 /gi=3242230 /len=2369 Length = 2369 Score = 32.2 bits (16), Expect = 0.80 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 5 ggtcttgttgggcatc 20 |||||||||||||||| Sbjct: 211 ggtcttgttgggcatc 196 Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq Posted date: Feb 17, 1999 1:37 AM Number of letters in database: 15,836,343 Number of sequences in database: 15,275 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2041 Number of Sequences: 15275 Number of extensions: 2041 Number of successful extensions: 595 Number of sequences better than 10: 12 length of query: 272 length of database: 15836343 effective HSP length: 16 effective length of query: 256 effective length of database: 15591943 effective search space: 3991537408 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)