BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 524e02 (343 letters) Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq 15,275 sequences; 15,836,343 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Mm.4638 Granule cell antiserum positive 8 /cds=(0,258) /... 48 2e-05 gnl|UG|Mm.20027 mm02b04.x1 Mus musculus cDNA, 3' end /clone=IMA... 42 0.001 gnl|UG|Mm.25020 C79245 Mus musculus cDNA, 3' end /clone=J0063B0... 38 0.017 gnl|UG|Mm.22861 mf28d09.x1 Mus musculus cDNA, 3' end /clone=IMA... 38 0.017 gnl|UG|Mm.23624 mi98b11.x1 Mus musculus cDNA, 3' end /clone=IMA... 36 0.066 >gnl|UG|Mm.4638 Granule cell antiserum positive 8 /cds=(0,258) /gb=L10908 /gi=192556 /len=1116 Length = 1116 Score = 48.1 bits (24), Expect = 2e-05 Identities = 24/24 (100%), Positives = 24/24 (100%) Query: 224 ggagttgattctctccttccacct 247 |||||||||||||||||||||||| Sbjct: 252 ggagttgattctctccttccacct 275 >gnl|UG|Mm.20027 mm02b04.x1 Mus musculus cDNA, 3' end /clone=IMAGE:520303 /clone_end=3' /gb=AI324963 /len=437 Length = 437 Score = 42.1 bits (21), Expect = 0.001 Identities = 27/29 (93%), Positives = 27/29 (93%) Query: 27 tatgaatgttttggctgcatgtatgtatg 55 ||||| ||||||| ||||||||||||||| Sbjct: 36 tatgagtgttttgtctgcatgtatgtatg 64 >gnl|UG|Mm.25020 C79245 Mus musculus cDNA, 3' end /clone=J0063B07 /clone_end=3' /gb=C79245 /gi=2519575 /len=500 Length = 500 Score = 38.2 bits (19), Expect = 0.017 Identities = 31/35 (88%), Positives = 31/35 (88%) Query: 201 tagaggtcataggacaactttgtggagttgattct 235 ||||||||| | |||||||||||| |||| ||||| Sbjct: 316 tagaggtcagaagacaactttgtgaagttaattct 350 >gnl|UG|Mm.22861 mf28d09.x1 Mus musculus cDNA, 3' end /clone=IMAGE:406385 /clone_end=3' /gb=AI413875 /len=303 Length = 303 Score = 38.2 bits (19), Expect = 0.017 Identities = 22/23 (95%), Positives = 22/23 (95%) Query: 95 agggcactggatcccctggaact 117 |||||||| |||||||||||||| Sbjct: 200 agggcactagatcccctggaact 178 >gnl|UG|Mm.23624 mi98b11.x1 Mus musculus cDNA, 3' end /clone=IMAGE:474621 /clone_end=3' /gb=AI430049 /len=450 Length = 450 Score = 36.2 bits (18), Expect = 0.066 Identities = 21/22 (95%), Positives = 21/22 (95%) Query: 33 tgttttggctgcatgtatgtat 54 ||||||| |||||||||||||| Sbjct: 264 tgttttgcctgcatgtatgtat 243 Score = 30.2 bits (15), Expect = 4.1 Identities = 15/15 (100%), Positives = 15/15 (100%) Query: 103 ggatcccctggaact 117 ||||||||||||||| Sbjct: 198 ggatcccctggaact 184 Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq Posted date: Feb 17, 1999 1:37 AM Number of letters in database: 15,836,343 Number of sequences in database: 15,275 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3539 Number of Sequences: 15275 Number of extensions: 3539 Number of successful extensions: 976 Number of sequences better than 10: 57 length of query: 343 length of database: 15836343 effective HSP length: 16 effective length of query: 327 effective length of database: 15591943 effective search space: 5098565361 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)