BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 402c07 (395 letters) Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq 15,275 sequences; 15,836,343 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Mm.3573 EST00786 Mus musculus cDNA, 3' end /clone=C0002F... 111 2e-24 gnl|UG|Mm.25050 C79829 Mus musculus cDNA, 3' end /clone=J0072E1... 111 2e-24 gnl|UG|Mm.4508 Colony stimulating factor, granulocyte receptor ... 105 1e-22 gnl|UG|Mm.16923 C80312 Mus musculus cDNA, 3' end /clone=J0079E1... 103 4e-22 gnl|UG|Mm.28154 mb99c08.r1 Mus musculus cDNA, 5' end /clone=IMA... 103 4e-22 >gnl|UG|Mm.3573 EST00786 Mus musculus cDNA, 3' end /clone=C0002F10 /clone_end=3' /gb=AA407512 /gi=2065701 /len=394 Length = 394 Score = 111 bits (56), Expect = 2e-24 Identities = 77/84 (91%), Positives = 77/84 (91%) Query: 7 tgtcctggaactcactatgtagaccagactggccttgaactcagagacctgcctgcctct 66 |||||||||||||||| |||||||||| ||||||||||||||||| | |||||||||||| Sbjct: 96 tgtcctggaactcactctgtagaccaggctggccttgaactcagaaatctgcctgcctct 37 Query: 67 gtctcccgagtactgggattaaag 90 | ||||| ||| |||||||||||| Sbjct: 36 gcctcccaagtgctgggattaaag 13 >gnl|UG|Mm.25050 C79829 Mus musculus cDNA, 3' end /clone=J0072E12 /clone_end=3' /gb=C79829 /gi=2520159 /len=576 Length = 576 Score = 111 bits (56), Expect = 2e-24 Identities = 77/84 (91%), Positives = 77/84 (91%) Query: 7 tgtcctggaactcactatgtagaccagactggccttgaactcagagacctgcctgcctct 66 |||||||||||||||| |||||||||| ||||||| ||||||||| | |||||||||||| Sbjct: 77 tgtcctggaactcactttgtagaccaggctggcctcgaactcagaaatctgcctgcctct 136 Query: 67 gtctcccgagtactgggattaaag 90 | ||||||||| |||||||||||| Sbjct: 137 gcctcccgagtgctgggattaaag 160 >gnl|UG|Mm.4508 Colony stimulating factor, granulocyte receptor /cds=(179,2692) /gb=M58288 /gi=193454 /len=3293 Length = 3293 Score = 105 bits (53), Expect = 1e-22 Identities = 80/89 (89%), Positives = 80/89 (89%) Query: 7 tgtcctggaactcactatgtagaccagactggccttgaactcagagacctgcctgcctct 66 |||||||||||||||| |||||||||| ||||||| ||||||||| | || ||||||||| Sbjct: 3215 tgtcctggaactcactttgtagaccaggctggcctcgaactcagaaatctacctgcctct 3156 Query: 67 gtctcccgagtactgggattaaagtcatg 95 | ||||||||| |||||||||||| |||| Sbjct: 3155 gcctcccgagtgctgggattaaaggcatg 3127 >gnl|UG|Mm.16923 C80312 Mus musculus cDNA, 3' end /clone=J0079E12 /clone_end=3' /gb=C80312 /gi=2520642 /len=601 Length = 601 Score = 103 bits (52), Expect = 4e-22 Identities = 76/84 (90%), Positives = 76/84 (90%) Query: 7 tgtcctggaactcactatgtagaccagactggccttgaactcagagacctgcctgcctct 66 |||||||||||| ||| |||||||||| ||||||| ||||||||||| | |||||||||| Sbjct: 30 tgtcctggaactaactctgtagaccaggctggcctcgaactcagagatccgcctgcctct 89 Query: 67 gtctcccgagtactgggattaaag 90 | ||||||||| |||||||||||| Sbjct: 90 gcctcccgagtgctgggattaaag 113 >gnl|UG|Mm.28154 mb99c08.r1 Mus musculus cDNA, 5' end /clone=IMAGE:337550 /clone_end=5' /gb=W29384 /gi=1309594 /len=1082 Length = 1082 Score = 103 bits (52), Expect = 4e-22 Identities = 76/84 (90%), Positives = 76/84 (90%) Query: 7 tgtcctggaactcactatgtagaccagactggccttgaactcagagacctgcctgcctct 66 |||||||||||||||| |||||||||| ||||||||||||||||| | | ||||||||| Sbjct: 19 tgtcctggaactcactctgtagaccaggctggccttgaactcagaaatccacctgcctct 78 Query: 67 gtctcccgagtactgggattaaag 90 | ||||||||| |||||||||||| Sbjct: 79 gcctcccgagtgctgggattaaag 102 Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq Posted date: Feb 17, 1999 1:37 AM Number of letters in database: 15,836,343 Number of sequences in database: 15,275 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3879 Number of Sequences: 15275 Number of extensions: 3879 Number of successful extensions: 1515 Number of sequences better than 10: 439 length of query: 395 length of database: 15836343 effective HSP length: 16 effective length of query: 379 effective length of database: 15591943 effective search space: 5909346397 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)