BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 187c05 (154 letters) Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq 15,275 sequences; 15,836,343 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Mm.25983 AU016428 Mus musculus cDNA, 3' end /clone=J0724... 54 1e-07 gnl|UG|Mm.8022 Mus musculus strain C57BL/6 zinc finger protein ... 46 3e-05 gnl|UG|Mm.24964 C77902 Mus musculus cDNA, 3' end /clone=J0039D1... 44 1e-04 gnl|UG|Mm.27079 uc73g04.x1 Mus musculus cDNA, 3' end /clone=IMA... 32 0.43 >gnl|UG|Mm.25983 AU016428 Mus musculus cDNA, 3' end /clone=J0724H10 /clone_end=3' /gb=AU016428 /gi=3371432 /len=498 Length = 498 Score = 54.0 bits (27), Expect = 1e-07 Identities = 42/47 (89%), Positives = 42/47 (89%) Query: 95 ttcattgctgtgaagagatcccatgaccaaaggaactcttataaagg 141 |||||||||||||||||| |||||||||| | |||| ||||||||| Sbjct: 211 ttcattgctgtgaagagacaccatgaccaaggcaacttttataaagg 257 >gnl|UG|Mm.8022 Mus musculus strain C57BL/6 zinc finger protein 106 (Zfp106) mRNA, H3a-a allele, complete cds /cds=(2290,7956) /gb=AF060246 /gi=3372656 /len=8428 Length = 8428 Score = 46.1 bits (23), Expect = 3e-05 Identities = 35/39 (89%), Positives = 35/39 (89%) Query: 100 tgctgtgaagagatcccatgaccaaaggaactcttataa 138 ||||||||| |||| |||||||||| | ||||||||||| Sbjct: 1261 tgctgtgaacagataccatgaccaaggcaactcttataa 1223 >gnl|UG|Mm.24964 C77902 Mus musculus cDNA, 3' end /clone=J0039D11 /clone_end=3' /gb=C77902 /gi=2518232 /len=583 Length = 583 Score = 44.1 bits (22), Expect = 1e-04 Identities = 37/42 (88%), Positives = 37/42 (88%) Query: 98 attgctgtgaagagatcccatgaccaaaggaactcttataaa 139 |||||| |||||||| |||||||||| | |||||||||||| Sbjct: 197 attgctatgaagagacaccatgaccaaggcaactcttataaa 238 >gnl|UG|Mm.27079 uc73g04.x1 Mus musculus cDNA, 3' end /clone=IMAGE:1431318 /clone_end=3' /gb=AA986740 /gi=3167742 /len=563 Length = 563 Score = 32.2 bits (16), Expect = 0.43 Identities = 25/28 (89%), Positives = 25/28 (89%) Query: 97 cattgctgtgaagagatcccatgaccaa 124 ||||||||||||| || |||||||||| Sbjct: 387 cattgctgtgaagggacaccatgaccaa 414 Score = 30.2 bits (15), Expect = 1.7 Identities = 15/15 (100%), Positives = 15/15 (100%) Query: 128 aactcttataaagga 142 ||||||||||||||| Sbjct: 428 aactcttataaagga 442 Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq Posted date: Feb 17, 1999 1:37 AM Number of letters in database: 15,836,343 Number of sequences in database: 15,275 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1050 Number of Sequences: 15275 Number of extensions: 1050 Number of successful extensions: 275 Number of sequences better than 10: 15 length of query: 154 length of database: 15836343 effective HSP length: 16 effective length of query: 138 effective length of database: 15591943 effective search space: 2151688134 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 14 (28.2 bits)