BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 103d10 (370 letters) Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq 15,275 sequences; 15,836,343 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Mm.7430 Ribosomal protein L7 /cds=(0,466) /gb=X57960 /gi... 46 7e-05 gnl|UG|Mm.17867 AU045692 Mus musculus cDNA, 3' end /clone=J0939... 40 0.005 gnl|UG|Mm.25982 AU016422 Mus musculus cDNA, 3' end /clone=J0724... 36 0.071 gnl|UG|Mm.28485 mw98d09.r1 Mus musculus cDNA, 5' end /clone=IMA... 36 0.071 gnl|UG|Mm.23387 mm37f04.x1 Mus musculus cDNA, 3' end /clone=IMA... 34 0.28 >gnl|UG|Mm.7430 Ribosomal protein L7 /cds=(0,466) /gb=X57960 /gi=53911 /len=904 Length = 904 Score = 46.1 bits (23), Expect = 7e-05 Identities = 35/39 (89%), Positives = 35/39 (89%) Query: 291 agatctgcctgtttgtgcctcctgagtcctggggttaaa 329 ||||||||||| | |||||||||||||||||| ||||| Sbjct: 710 agatctgcctgactctgcctcctgagtcctgggattaaa 748 >gnl|UG|Mm.17867 AU045692 Mus musculus cDNA, 3' end /clone=J0939H11 /clone_end=3' /gb=AU045692 /gi=3981875 /len=525 Length = 525 Score = 40.1 bits (20), Expect = 0.005 Identities = 29/32 (90%), Positives = 29/32 (90%) Query: 306 tgcctcctgagtcctggggttaaaagtgtgca 337 |||||||||||| ||||| ||||| ||||||| Sbjct: 109 tgcctcctgagtgctgggattaaaggtgtgca 140 >gnl|UG|Mm.25982 AU016422 Mus musculus cDNA, 3' end /clone=J0724H03 /clone_end=3' /gb=AU016422 /gi=3371426 /len=605 Length = 605 Score = 36.2 bits (18), Expect = 0.071 Identities = 27/30 (90%), Positives = 27/30 (90%) Query: 306 tgcctcctgagtcctggggttaaaagtgtg 335 |||||||||||| ||||| ||||| ||||| Sbjct: 205 tgcctcctgagtgctgggattaaaggtgtg 234 >gnl|UG|Mm.28485 mw98d09.r1 Mus musculus cDNA, 5' end /clone=IMAGE:678737 /clone_end=5' /gb=AA237368 /gi=1861390 /len=560 Length = 560 Score = 36.2 bits (18), Expect = 0.071 Identities = 24/26 (92%), Positives = 24/26 (92%) Query: 306 tgcctcctgagtcctggggttaaaag 331 |||||||||||| ||||| ||||||| Sbjct: 230 tgcctcctgagtgctgggattaaaag 205 >gnl|UG|Mm.23387 mm37f04.x1 Mus musculus cDNA, 3' end /clone=IMAGE:523711 /clone_end=3' /gb=AI428056 /len=394 Length = 394 Score = 34.2 bits (17), Expect = 0.28 Identities = 32/37 (86%), Positives = 32/37 (86%) Query: 293 atctgcctgtttgtgcctcctgagtcctggggttaaa 329 ||||||||| | |||||||||||| ||||| ||||| Sbjct: 84 atctgcctgcctctgcctcctgagtgctgggattaaa 120 Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq Posted date: Feb 17, 1999 1:37 AM Number of letters in database: 15,836,343 Number of sequences in database: 15,275 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3053 Number of Sequences: 15275 Number of extensions: 3053 Number of successful extensions: 1223 Number of sequences better than 10: 71 length of query: 370 length of database: 15836343 effective HSP length: 16 effective length of query: 354 effective length of database: 15591943 effective search space: 5519547822 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)