BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 089a10 (376 letters) Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq 15,275 sequences; 15,836,343 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Mm.4989 Murine tlm oncogene for tlm protein /cds=(0,953)... 135 1e-31 gnl|UG|Mm.24396 mb93g07.r1 Mus musculus cDNA, 5' end /clone=IMA... 84 3e-16 gnl|UG|Mm.28372 C77608 Mus musculus cDNA, 3' end /clone=J0034E0... 84 3e-16 gnl|UG|Mm.5763 C78885 Mus musculus cDNA, 3' end /clone=J0056G12... 64 3e-10 gnl|UG|Mm.26877 AU044722 Mus musculus cDNA, 3' end /clone=J0924... 44 3e-04 >gnl|UG|Mm.4989 Murine tlm oncogene for tlm protein /cds=(0,953) /gb=X52634 /gi=53528 /len=1425 Length = 1425 Score = 135 bits (68), Expect = 1e-31 Identities = 101/112 (90%), Positives = 101/112 (90%) Query: 244 aacagatgctggcgaggatgtggagaaagaggaacactcctccattgttggtgagattgc 303 ||||||||||| |||||||||||||||||| | |||||||||||||| |||||||||||| Sbjct: 788 aacagatgctgacgaggatgtggagaaagaaggacactcctccattgctggtgagattgc 729 Query: 304 aaactggtacaaccattctggaaatcagtctggaggttcctcagaaaattgg 355 || || ||||||||| ||||||||||||| || ||||||||||||||||| Sbjct: 728 aagctagtacaaccactctggaaatcagtttgacagttcctcagaaaattgg 677 >gnl|UG|Mm.24396 mb93g07.r1 Mus musculus cDNA, 5' end /clone=IMAGE:337020 /clone_end=5' /gb=W20915 /gi=1297840 /len=363 Length = 363 Score = 83.8 bits (42), Expect = 3e-16 Identities = 53/57 (92%), Positives = 53/57 (92%) Query: 4 cgaacccagggccttgggcttcntaggcaagcgctctaccactgagctaaatcccca 60 ||||||||||||||||||||| ||||||||| || ||||||||||||||||||||| Sbjct: 336 cgaacccagggccttgggcttgctaggcaagcactttaccactgagctaaatcccca 280 >gnl|UG|Mm.28372 C77608 Mus musculus cDNA, 3' end /clone=J0034E02 /clone_end=3' /gb=C77608 /gi=2517938 /len=551 Length = 551 Score = 83.8 bits (42), Expect = 3e-16 Identities = 53/57 (92%), Positives = 53/57 (92%) Query: 4 cgaacccagggccttgggcttcntaggcaagcgctctaccactgagctaaatcccca 60 |||||||||||||||| |||| ||||||||| |||||||||||||||||||||||| Sbjct: 66 cgaacccagggccttgtgcttgctaggcaagcactctaccactgagctaaatcccca 122 >gnl|UG|Mm.5763 C78885 Mus musculus cDNA, 3' end /clone=J0056G12 /clone_end=3' /gb=C78885 /gi=2519215 /len=597 Length = 597 Score = 63.9 bits (32), Expect = 3e-10 Identities = 60/68 (88%), Positives = 60/68 (88%), Gaps = 1/68 (1%) Query: 310 gtacaaccattctggaaatcagtctgga-ggttcctcagaaaattggacattgaactgcc 368 ||||||||| ||||||||||||| ||| |||||||||||||||||||||| | ||| || Sbjct: 477 gtacaaccactctggaaatcagtatgggcggttcctcagaaaattggacatagtactacc 536 Query: 369 tgaggatc 376 ||||||| Sbjct: 537 ggaggatc 544 >gnl|UG|Mm.26877 AU044722 Mus musculus cDNA, 3' end /clone=J0924B10 /clone_end=3' /gb=AU044722 /gi=3980905 /len=569 Length = 569 Score = 44.1 bits (22), Expect = 3e-04 Identities = 25/26 (96%), Positives = 25/26 (96%) Query: 328 tcagtctggaggttcctcagaaaatt 353 ||||||||| |||||||||||||||| Sbjct: 543 tcagtctggcggttcctcagaaaatt 568 Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq Posted date: Feb 17, 1999 1:37 AM Number of letters in database: 15,836,343 Number of sequences in database: 15,275 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2513 Number of Sequences: 15275 Number of extensions: 2513 Number of successful extensions: 742 Number of sequences better than 10: 33 length of query: 376 length of database: 15836343 effective HSP length: 16 effective length of query: 360 effective length of database: 15591943 effective search space: 5613099480 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)