BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 057b12 (401 letters) Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq 15,275 sequences; 15,836,343 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Mm.29577 AU019293 Mus musculus cDNA, 3' end /clone=J0515... 80 6e-15 gnl|UG|Mm.857 MTA.E03.070.C Mus musculus cDNA, 3' end /clone=MT... 78 2e-14 gnl|UG|Mm.10628 mt14e12.r1 Mus musculus cDNA, 5' end /clone=IMA... 78 2e-14 gnl|UG|Mm.25676 vw60a12.s1 Mus musculus cDNA, 3' end /clone=IMA... 78 2e-14 gnl|UG|Mm.26202 AU020572 Mus musculus cDNA, 3' end /clone=J0534... 74 4e-13 >gnl|UG|Mm.29577 AU019293 Mus musculus cDNA, 3' end /clone=J0515F12 /clone_end=3' /gb=AU019293 /gi=3374877 /len=510 Length = 510 Score = 79.8 bits (40), Expect = 6e-15 Identities = 52/56 (92%), Positives = 52/56 (92%) Query: 326 gagacaatgtttctctgtgtagccctggctatcctggaactctctctgtagtccag 381 ||||||| |||| ||||||||||||||||||||||||||||| |||||||| |||| Sbjct: 2 gagacaaggtttttctgtgtagccctggctatcctggaactcactctgtagaccag 57 >gnl|UG|Mm.857 MTA.E03.070.C Mus musculus cDNA, 3' end /clone=MTA.E03.070 /clone_end=3' /gb=W91592 /gi=1408018 /len=330 Length = 330 Score = 77.8 bits (39), Expect = 2e-14 Identities = 48/51 (94%), Positives = 48/51 (94%) Query: 326 gagacaatgtttctctgtgtagccctggctatcctggaactctctctgtag 376 |||||| ||||||||||||||||||||||| ||||||||||| |||||||| Sbjct: 2 gagacagtgtttctctgtgtagccctggctgtcctggaactcactctgtag 52 >gnl|UG|Mm.10628 mt14e12.r1 Mus musculus cDNA, 5' end /clone=IMAGE:621070 /clone_end=5' /gb=AA178143 /gi=1759378 /len=446 Length = 446 Score = 77.8 bits (39), Expect = 2e-14 Identities = 51/55 (92%), Positives = 51/55 (92%) Query: 327 agacaatgtttctctgtgtagccctggctatcctggaactctctctgtagtccag 381 |||||| |||||||||||||||||||||| ||||||||||| |||||||| |||| Sbjct: 283 agacaaggtttctctgtgtagccctggctgtcctggaactcactctgtagaccag 337 >gnl|UG|Mm.25676 vw60a12.s1 Mus musculus cDNA, 3' end /clone=IMAGE:1248190 /clone_end=3' /gb=AA960139 /gi=3126039 /len=454 Length = 454 Score = 77.8 bits (39), Expect = 2e-14 Identities = 62/67 (92%), Positives = 62/67 (92%), Gaps = 2/67 (2%) Query: 334 gtttctctgtgtagccctggctatcctggaactctctctgtagtccag-ctagcctttga 392 |||||||||||||||||||||||||||||||||| |||||||| ||| ||||| ||||| Sbjct: 14 gtttctctgtgtagccctggctatcctggaactcactctgtagatcaggctagc-tttga 72 Query: 393 actcaga 399 ||||||| Sbjct: 73 actcaga 79 >gnl|UG|Mm.26202 AU020572 Mus musculus cDNA, 3' end /clone=J0534G07 /clone_end=3' /gb=AU020572 /gi=3376156 /len=591 Length = 591 Score = 73.8 bits (37), Expect = 4e-13 Identities = 55/61 (90%), Positives = 55/61 (90%) Query: 321 ctttggagacaatgtttctctgtgtagccctggctatcctggaactctctctgtagtcca 380 ||||||||||| |||||||||| ||||||||||| ||||||||||| |||||||| ||| Sbjct: 2 ctttggagacagggtttctctgtatagccctggctgtcctggaactcactctgtagacca 61 Query: 381 g 381 | Sbjct: 62 g 62 Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq Posted date: Feb 17, 1999 1:37 AM Number of letters in database: 15,836,343 Number of sequences in database: 15,275 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3874 Number of Sequences: 15275 Number of extensions: 3874 Number of successful extensions: 1337 Number of sequences better than 10: 341 length of query: 401 length of database: 15836343 effective HSP length: 16 effective length of query: 385 effective length of database: 15591943 effective search space: 6002898055 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)