BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 01433 (331 letters) Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq 15,275 sequences; 15,836,343 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Mm.28485 mw98d09.r1 Mus musculus cDNA, 5' end /clone=IMA... 56 7e-08 gnl|UG|Mm.26895 AU018886 Mus musculus cDNA, 3' end /clone=J0509... 52 1e-06 gnl|UG|Mm.24650 vh12e01.r1 Mus musculus cDNA, 5' end /clone=IMA... 46 7e-05 gnl|UG|Mm.25098 C81070 Mus musculus cDNA, 3' end /clone=J0093A1... 46 7e-05 gnl|UG|Mm.3379 M.musculus mRNA for hydroxymethyltransferase (mS... 44 3e-04 >gnl|UG|Mm.28485 mw98d09.r1 Mus musculus cDNA, 5' end /clone=IMAGE:678737 /clone_end=5' /gb=AA237368 /gi=1861390 /len=560 Length = 560 Score = 56.0 bits (28), Expect = 7e-08 Identities = 38/40 (95%), Positives = 38/40 (95%), Gaps = 1/40 (2%) Query: 293 cttttaatcccagcacttag-aggcagaggcaagtggatc 331 ||||||||||||||||| || ||||||||||||||||||| Sbjct: 205 cttttaatcccagcactcaggaggcagaggcaagtggatc 244 >gnl|UG|Mm.26895 AU018886 Mus musculus cDNA, 3' end /clone=J0509E11 /clone_end=3' /gb=AU018886 /gi=3374376 /len=569 Length = 569 Score = 52.0 bits (26), Expect = 1e-06 Identities = 32/34 (94%), Positives = 32/34 (94%) Query: 290 acacttttaatcccagcacttagaggcagaggca 323 |||| |||||||||||||||| |||||||||||| Sbjct: 356 acacctttaatcccagcacttggaggcagaggca 323 >gnl|UG|Mm.24650 vh12e01.r1 Mus musculus cDNA, 5' end /clone=IMAGE:875256 /clone_end=5' /gb=AA475830 /gi=2203681 /len=590 Length = 590 Score = 46.1 bits (23), Expect = 7e-05 Identities = 26/27 (96%), Positives = 26/27 (96%) Query: 283 gtggtgtacacttttaatcccagcact 309 ||||||||||||| ||||||||||||| Sbjct: 19 gtggtgtacacttataatcccagcact 45 >gnl|UG|Mm.25098 C81070 Mus musculus cDNA, 3' end /clone=J0093A10 /clone_end=3' /gb=C81070 /gi=2521400 /len=579 Length = 579 Score = 46.1 bits (23), Expect = 7e-05 Identities = 45/51 (88%), Positives = 45/51 (88%), Gaps = 1/51 (1%) Query: 281 tagtggtgtacacttttaatcccagcactt-agaggcagaggcaagtggat 330 |||||||| || | |||||||||||||||| |||||||||||| |||||| Sbjct: 127 tagtggtgcacgcctttaatcccagcacttgggaggcagaggcaggtggat 77 >gnl|UG|Mm.3379 M.musculus mRNA for hydroxymethyltransferase (mSHMT1) /cds=(207,1136) /gb=X94478 /gi=1139578 /len=1284 Length = 1284 Score = 44.1 bits (22), Expect = 3e-04 Identities = 35/38 (92%), Positives = 35/38 (92%), Gaps = 1/38 (2%) Query: 295 tttaatcccagcacttag-aggcagaggcaagtggatc 331 ||||||||||||||| | ||||||||||||||||||| Sbjct: 41 tttaatcccagcactagggaggcagaggcaagtggatc 4 Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq Posted date: Feb 17, 1999 1:37 AM Number of letters in database: 15,836,343 Number of sequences in database: 15,275 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3039 Number of Sequences: 15275 Number of extensions: 3039 Number of successful extensions: 1197 Number of sequences better than 10: 233 length of query: 331 length of database: 15836343 effective HSP length: 16 effective length of query: 315 effective length of database: 15591943 effective search space: 4911462045 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)