BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 00802 (318 letters) Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq 15,275 sequences; 15,836,343 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Mm.17841 AU045821 Mus musculus cDNA, 3' end /clone=J0942... 72 1e-12 gnl|UG|Mm.12270 AU045746 Mus musculus cDNA, 3' end /clone=J0940... 66 7e-11 gnl|UG|Mm.7275 Small inducible cytokine A25 /cds=(0,434) /gb=U8... 34 0.24 gnl|UG|Mm.22769 Mouse murinoglobulin (MUG3) mRNA, last 2 exons ... 32 0.95 gnl|UG|Mm.193 Intergral membrane protein 2 /cds=(147,938) /gb=L... 32 0.95 >gnl|UG|Mm.17841 AU045821 Mus musculus cDNA, 3' end /clone=J0942C06 /clone_end=3' /gb=AU045821 /gi=3982004 /len=512 Length = 512 Score = 71.9 bits (36), Expect = 1e-12 Identities = 70/80 (87%), Positives = 70/80 (87%), Gaps = 1/80 (1%) Query: 139 ctaaacctgataaacaccttcagcaa-agtggctgggtataaaattaactcaaataagtc 197 ||||| |||||||||| ||||||| | ||| ||||| ||||||||||||||||| || || Sbjct: 429 ctaaatctgataaacagcttcagccacagtagctggatataaaattaactcaaacaaatc 370 Query: 198 agtagccttcctctacacaa 217 ||| ||||| |||||||||| Sbjct: 369 agtggcctttctctacacaa 350 >gnl|UG|Mm.12270 AU045746 Mus musculus cDNA, 3' end /clone=J0940F11 /clone_end=3' /gb=AU045746 /gi=3981929 /len=454 Length = 454 Score = 54.0 bits (27), Expect = 3e-07 Identities = 60/71 (84%), Positives = 60/71 (84%) Query: 118 aaaagttccaccagagaagtactaaacctgataaacaccttcagcaaagtggctgggtat 177 |||| ||| ||||||||| | |||||||||||||||| |||| | |||| ||||| ||| Sbjct: 71 aaaaattctaccagagaactcctaaacctgataaacagcttcggtgaagtagctggatat 12 Query: 178 aaaattaactc 188 ||||| ||||| Sbjct: 11 aaaataaactc 1 Score = 65.9 bits (33), Expect = 7e-11 Identities = 58/65 (89%), Positives = 58/65 (89%), Gaps = 1/65 (1%) Query: 1 gatcaaagggatacagtttggaaaggaagaagtcaaa-tatcactatttgcagatgatat 59 |||||| |||||||| ||||||| || ||||||||| ||||||| |||||||||||||| Sbjct: 153 gatcaaggggatacaaattggaaaagaggaagtcaaaatatcactttttgcagatgatat 94 Query: 60 gatag 64 ||||| Sbjct: 93 gatag 89 >gnl|UG|Mm.7275 Small inducible cytokine A25 /cds=(0,434) /gb=U86357 /gi=2388628 /len=892 Length = 892 Score = 34.2 bits (17), Expect = 0.24 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 21 gaaaggaagaagtcaaa 37 ||||||||||||||||| Sbjct: 316 gaaaggaagaagtcaaa 332 >gnl|UG|Mm.22769 Mouse murinoglobulin (MUG3) mRNA, last 2 exons /cds=UNKNOWN /gb=M65237 /gi=199886 /len=3293 Length = 3293 Score = 32.2 bits (16), Expect = 0.95 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 113 ttcccaaaagttccac 128 |||||||||||||||| Sbjct: 2601 ttcccaaaagttccac 2616 >gnl|UG|Mm.193 Intergral membrane protein 2 /cds=(147,938) /gb=L38971 /gi=624777 /len=1635 Length = 1635 Score = 32.2 bits (16), Expect = 0.95 Identities = 19/20 (95%), Positives = 19/20 (95%) Query: 113 ttcccaaaagttccaccaga 132 |||| ||||||||||||||| Sbjct: 691 ttccaaaaagttccaccaga 672 Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq Posted date: Feb 17, 1999 1:37 AM Number of letters in database: 15,836,343 Number of sequences in database: 15,275 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2380 Number of Sequences: 15275 Number of extensions: 2380 Number of successful extensions: 619 Number of sequences better than 10: 24 length of query: 318 length of database: 15836343 effective HSP length: 16 effective length of query: 302 effective length of database: 15591943 effective search space: 4708766786 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)