BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 00071 (458 letters) Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq 15,275 sequences; 15,836,343 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Mm.18916 Glutamate oxaloacetate transaminase 2, mitochon... 74 4e-13 gnl|UG|Mm.1466 Inhibitor of DNA binding 2 /cds=(0,480) /gb=M692... 34 0.35 gnl|UG|Mm.7248 Solute carrier family 4 (anion exchanger), membe... 34 0.35 gnl|UG|Mm.21776 M.musculus h2-calponin cDNA /cds=(0,917) /gb=Z1... 32 1.4 gnl|UG|Mm.6680 Mus musculus neural plakophilin related arm-repe... 32 1.4 >gnl|UG|Mm.18916 Glutamate oxaloacetate transaminase 2, mitochondrial /cds=(717,2009) /gb=X06917 /gi=13935 /len=3003 Length = 3003 Score = 73.8 bits (37), Expect = 4e-13 Identities = 37/37 (100%), Positives = 37/37 (100%) Query: 422 cagctcctggtggacccatgttgaaatgggacctcca 458 ||||||||||||||||||||||||||||||||||||| Sbjct: 804 cagctcctggtggacccatgttgaaatgggacctcca 840 >gnl|UG|Mm.1466 Inhibitor of DNA binding 2 /cds=(0,480) /gb=M69293 /gi=1030073 /len=1262 Length = 1262 Score = 34.2 bits (17), Expect = 0.35 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 298 ctgaaggctttcatgct 314 ||||||||||||||||| Sbjct: 90 ctgaaggctttcatgct 74 >gnl|UG|Mm.7248 Solute carrier family 4 (anion exchanger), member 1 /cds=(126,2915) /gb=X02677 /gi=49897 /len=4375 Length = 4375 Score = 34.2 bits (17), Expect = 0.35 Identities = 20/21 (95%), Positives = 20/21 (95%) Query: 358 tggcagagacatacctggctg 378 |||||||||||| |||||||| Sbjct: 536 tggcagagacatccctggctg 556 >gnl|UG|Mm.21776 M.musculus h2-calponin cDNA /cds=(0,917) /gb=Z19543 /gi=51143 /len=918 Length = 918 Score = 32.2 bits (16), Expect = 1.4 Identities = 19/20 (95%), Positives = 19/20 (95%) Query: 321 tagctggtgcctgttctgca 340 ||||||||||| |||||||| Sbjct: 255 tagctggtgccagttctgca 236 >gnl|UG|Mm.6680 Mus musculus neural plakophilin related arm-repeat protein (NPRAP) mRNA, complete cds /cds=(534,4277) /gb=U90331 /gi=2580536 /len=4998 Length = 4998 Score = 32.2 bits (16), Expect = 1.4 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 422 cagctcctggtggacc 437 |||||||||||||||| Sbjct: 2308 cagctcctggtggacc 2323 Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq Posted date: Feb 17, 1999 1:37 AM Number of letters in database: 15,836,343 Number of sequences in database: 15,275 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2730 Number of Sequences: 15275 Number of extensions: 2730 Number of successful extensions: 693 Number of sequences better than 10: 5 length of query: 458 length of database: 15836343 effective HSP length: 17 effective length of query: 441 effective length of database: 15576668 effective search space: 6869310588 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)