BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= D9Rat36 (544 letters) Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq 15,275 sequences; 15,836,343 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Mm.4463 Vasoactive intestinal peptide receptor 2 /cds=(5... 34 0.42 gnl|UG|Mm.26778 ui59g06.x1 Mus musculus cDNA, 3' end /clone=IMA... 34 0.42 gnl|UG|Mm.24741 Mus musculus glutamate transporter mRNA, comple... 34 0.42 gnl|UG|Mm.28904 mc40a03.x1 Mus musculus cDNA, 3' end /clone=IMA... 34 0.42 gnl|UG|Mm.18688 ui62c11.x1 Mus musculus cDNA, 3' end /clone=IMA... 32 1.7 >gnl|UG|Mm.4463 Vasoactive intestinal peptide receptor 2 /cds=(52,1365) /gb=D28132 /gi=473721 /len=2445 Length = 2445 Score = 34.2 bits (17), Expect = 0.42 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 10 ccttgaccagcacagag 26 ||||||||||||||||| Sbjct: 587 ccttgaccagcacagag 571 >gnl|UG|Mm.26778 ui59g06.x1 Mus musculus cDNA, 3' end /clone=IMAGE:1886746 /clone_end=3' /gb=AI195035 /gi=3747641 /len=474 Length = 474 Score = 34.2 bits (17), Expect = 0.42 Identities = 20/21 (95%), Positives = 20/21 (95%) Query: 180 attacaggtgtacaccaccaa 200 |||| |||||||||||||||| Sbjct: 50 attaaaggtgtacaccaccaa 30 >gnl|UG|Mm.24741 Mus musculus glutamate transporter mRNA, complete cds /cds=(76,1647) /gb=U73521 /gi=2459551 /len=3709 Length = 3709 Score = 34.2 bits (17), Expect = 0.42 Identities = 20/21 (95%), Positives = 20/21 (95%) Query: 78 acctcacctccagccactctc 98 |||||| |||||||||||||| Sbjct: 2133 acctcatctccagccactctc 2153 >gnl|UG|Mm.28904 mc40a03.x1 Mus musculus cDNA, 3' end /clone=IMAGE:350956 /clone_end=3' /gb=AI415398 /len=480 Length = 480 Score = 34.2 bits (17), Expect = 0.42 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 50 agtgcctgtcctgggtg 66 ||||||||||||||||| Sbjct: 338 agtgcctgtcctgggtg 322 >gnl|UG|Mm.18688 ui62c11.x1 Mus musculus cDNA, 3' end /clone=IMAGE:1886996 /clone_end=3' /gb=AI195241 /gi=3747847 /len=920 Length = 920 Score = 32.2 bits (16), Expect = 1.7 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 127 ggcctggagttcacag 142 |||||||||||||||| Sbjct: 911 ggcctggagttcacag 896 Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq Posted date: Feb 17, 1999 1:37 AM Number of letters in database: 15,836,343 Number of sequences in database: 15,275 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3891 Number of Sequences: 15275 Number of extensions: 3891 Number of successful extensions: 313 Number of sequences better than 10: 12 length of query: 544 length of database: 15836343 effective HSP length: 17 effective length of query: 527 effective length of database: 15576668 effective search space: 8208904036 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)