BLASTN 2.0.5 [May-5-1998]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= D3Rat52
         (737 letters)

Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq
           15,275 sequences; 15,836,343 total letters

Searching..................................................done

                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

gnl|UG|Mm.2168 Hemolytic complement /cds=(13,5055) /gb=M35525 /...   188  2e-47
gnl|UG|Mm.6813 M.musculus mRNA for bone morphogenetic protein 4...    72  3e-12
gnl|UG|Mm.12508 Karyopherin (importin) alpha 2 /cds=(177,1766) ...    64  6e-10
gnl|UG|Mm.4196 vh78d01.r1 Mus musculus cDNA, 3' end /clone=IMAG...    50  1e-05
gnl|UG|Mm.6878 vh81g07.r1 Mus musculus cDNA, 3' end /clone=IMAG...    46  2e-04

>gnl|UG|Mm.2168 Hemolytic complement /cds=(13,5055) /gb=M35525
            /gi=192304 /len=5403
            Length = 5403
            
 Score =  188 bits (95), Expect = 2e-47
 Identities = 136/150 (90%), Positives = 136/150 (90%)

                                                                        
Query: 309  agttctgtgttaaaatgtctgccgtggagggaatctgcactccaggaagctcggctgcta 368
            |||||||||||||||||||||| |||||||| ||||||||| |||||||||| |||||||
Sbjct: 2586 agttctgtgttaaaatgtctgctgtggaggggatctgcacttcaggaagctcagctgcta 2645

                                                                        
Query: 369  gccctcagacctctaggtcctccagatgtgtgcgccagagaatagagggctcctccagtc 428
            ||| ||| ||||| ||| ||||||||||||||  |||||| ||||||||||| |||||||
Sbjct: 2646 gccttcacacctccaggccctccagatgtgtgttccagaggatagagggctcgtccagtc 2705

                                          
Query: 429  acttggtgaccttcagnctgcttcctctgg 458
            |||||||||||||||  |||||||||||||
Sbjct: 2706 acttggtgaccttcaccctgcttcctctgg 2735


>gnl|UG|Mm.6813 M.musculus mRNA for bone morphogenetic protein 4
            (BMP-4) /cds=(356,1582) /gb=X56848 /gi=50180 /len=1785
            Length = 1785
            
 Score = 71.9 bits (36), Expect = 3e-12
 Identities = 36/36 (100%), Positives = 36/36 (100%)

                                                
Query: 6    gcttgcatgcctgcaggtcgactctagaggatcccc 41
            ||||||||||||||||||||||||||||||||||||
Sbjct: 1785 gcttgcatgcctgcaggtcgactctagaggatcccc 1750


 Score = 38.2 bits (19), Expect = 0.037
 Identities = 19/19 (100%), Positives = 19/19 (100%)

                               
Query: 466  gggtaccgagctcgaattc 484
            |||||||||||||||||||
Sbjct: 1749 gggtaccgagctcgaattc 1731


>gnl|UG|Mm.12508 Karyopherin (importin) alpha 2 /cds=(177,1766)
          /gb=D55720 /gi=893392 /len=2048
          Length = 2048
          
 Score = 63.9 bits (32), Expect = 6e-10
 Identities = 32/32 (100%), Positives = 32/32 (100%)

                                          
Query: 10 gcatgcctgcaggtcgactctagaggatcccc 41
          ||||||||||||||||||||||||||||||||
Sbjct: 1  gcatgcctgcaggtcgactctagaggatcccc 32


 Score = 40.1 bits (20), Expect = 0.009
 Identities = 20/20 (100%), Positives = 20/20 (100%)

                               
Query: 466 gggtaccgagctcgaattcg 485
           ||||||||||||||||||||
Sbjct: 33  gggtaccgagctcgaattcg 52


>gnl|UG|Mm.4196 vh78d01.r1 Mus musculus cDNA, 3' end
          /clone=IMAGE:893089 /clone_end=3' /gb=AA511261
          /gi=2249115 /len=342
          Length = 342
          
 Score = 50.1 bits (25), Expect = 1e-05
 Identities = 25/25 (100%), Positives = 25/25 (100%)

                                   
Query: 12 atgcctgcaggtcgactctagagga 36
          |||||||||||||||||||||||||
Sbjct: 1  atgcctgcaggtcgactctagagga 25


>gnl|UG|Mm.6878 vh81g07.r1 Mus musculus cDNA, 3' end
          /clone=IMAGE:893436 /clone_end=3' /gb=AA517755
          /gi=2257279 /len=485
          Length = 485
          
 Score = 46.1 bits (23), Expect = 2e-04
 Identities = 23/23 (100%), Positives = 23/23 (100%)

                                 
Query: 11 catgcctgcaggtcgactctaga 33
          |||||||||||||||||||||||
Sbjct: 1  catgcctgcaggtcgactctaga 23


  Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq
    Posted date:  Feb 17, 1999  1:37 AM
  Number of letters in database: 15,836,343
  Number of sequences in database:  15,275
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4004
Number of Sequences: 15275
Number of extensions: 4004
Number of successful extensions: 281
Number of sequences better than 10: 21
length of query: 737
length of database: 15836343
effective HSP length: 17
effective length of query: 720
effective length of database: 15576668
effective search space: 11215200960
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 25 (49.6 bits)
S1: 0 ( 0.5 bits)
S2: 15 (30.2 bits)