BLASTN 2.0.5 [May-5-1998]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= D19Rat13
         (619 letters)

Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq
           15,275 sequences; 15,836,343 total letters

Searching..................................................done

                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

gnl|UG|Mm.4219 Mannosidase 2, alpha B1 /cds=(70,3045) /gb=U2994...   161  3e-39
gnl|UG|Mm.6813 M.musculus mRNA for bone morphogenetic protein 4...    52  2e-06
gnl|UG|Mm.12508 Karyopherin (importin) alpha 2 /cds=(177,1766) ...    52  2e-06
gnl|UG|Mm.4196 vh78d01.r1 Mus musculus cDNA, 3' end /clone=IMAG...    42  0.002
gnl|UG|Mm.10826 Uromodulin /cds=(129,2057) /gb=L33406 /gi=92720...    42  0.002

>gnl|UG|Mm.4219 Mannosidase 2, alpha B1 /cds=(70,3045) /gb=U29947
            /gi=1478073 /len=3123
            Length = 3123
            
 Score =  161 bits (81), Expect = 3e-39
 Identities = 84/85 (98%), Positives = 84/85 (98%)

                                                                        
Query: 374  ttaccgaaccaaccacaccgtgatgaccatgggctcagacttccagtatgagaatgccaa 433
            ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 922  ttaccgaaccaaccacaccgtgatgaccatgggctcagacttccattatgagaatgccaa 981

                                     
Query: 434  catgtggttcaaaaacatggacaag 458
            |||||||||||||||||||||||||
Sbjct: 982  catgtggttcaaaaacatggacaag 1006


>gnl|UG|Mm.6813 M.musculus mRNA for bone morphogenetic protein 4
            (BMP-4) /cds=(356,1582) /gb=X56848 /gi=50180 /len=1785
            Length = 1785
            
 Score = 52.0 bits (26), Expect = 2e-06
 Identities = 26/26 (100%), Positives = 26/26 (100%)

                                      
Query: 6    ctgcaggtcgactctagaggatcccc 31
            ||||||||||||||||||||||||||
Sbjct: 1775 ctgcaggtcgactctagaggatcccc 1750


 Score = 38.2 bits (19), Expect = 0.031
 Identities = 19/19 (100%), Positives = 19/19 (100%)

                               
Query: 458  gggtaccgagctcgaattc 476
            |||||||||||||||||||
Sbjct: 1749 gggtaccgagctcgaattc 1731


>gnl|UG|Mm.12508 Karyopherin (importin) alpha 2 /cds=(177,1766)
          /gb=D55720 /gi=893392 /len=2048
          Length = 2048
          
 Score = 52.0 bits (26), Expect = 2e-06
 Identities = 26/26 (100%), Positives = 26/26 (100%)

                                    
Query: 6  ctgcaggtcgactctagaggatcccc 31
          ||||||||||||||||||||||||||
Sbjct: 7  ctgcaggtcgactctagaggatcccc 32


 Score = 40.1 bits (20), Expect = 0.008
 Identities = 20/20 (100%), Positives = 20/20 (100%)

                               
Query: 458 gggtaccgagctcgaattcg 477
           ||||||||||||||||||||
Sbjct: 33  gggtaccgagctcgaattcg 52


>gnl|UG|Mm.4196 vh78d01.r1 Mus musculus cDNA, 3' end
          /clone=IMAGE:893089 /clone_end=3' /gb=AA511261
          /gi=2249115 /len=342
          Length = 342
          
 Score = 42.1 bits (21), Expect = 0.002
 Identities = 21/21 (100%), Positives = 21/21 (100%)

                               
Query: 6  ctgcaggtcgactctagagga 26
          |||||||||||||||||||||
Sbjct: 5  ctgcaggtcgactctagagga 25


>gnl|UG|Mm.10826 Uromodulin /cds=(129,2057) /gb=L33406 /gi=927202
            /len=2343
            Length = 2343
            
 Score = 42.1 bits (21), Expect = 0.002
 Identities = 21/21 (100%), Positives = 21/21 (100%)

                                 
Query: 471  gaattcgtaatcatggtcata 491
            |||||||||||||||||||||
Sbjct: 2323 gaattcgtaatcatggtcata 2343


  Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq
    Posted date:  Feb 17, 1999  1:37 AM
  Number of letters in database: 15,836,343
  Number of sequences in database:  15,275
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4689
Number of Sequences: 15275
Number of extensions: 4689
Number of successful extensions: 404
Number of sequences better than 10: 31
length of query: 619
length of database: 15836343
effective HSP length: 17
effective length of query: 602
effective length of database: 15576668
effective search space: 9377154136
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 25 (49.6 bits)
S1: 0 ( 0.5 bits)
S2: 15 (30.2 bits)