BLASTN 2.0.5 [May-5-1998]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= D18Rat36
         (372 letters)

Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq
           15,275 sequences; 15,836,343 total letters

Searching..................................................done

                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

gnl|UG|Mm.28372 C77608 Mus musculus cDNA, 3' end /clone=J0034E0...   131  2e-30
gnl|UG|Mm.24396 mb93g07.r1 Mus musculus cDNA, 5' end /clone=IMA...   109  6e-24
gnl|UG|Mm.28012 vh59a01.r1 Mus musculus cDNA, 5' end /clone=IMA...    52  1e-06
gnl|UG|Mm.177 vp31b10.r1 Mus musculus cDNA, 5' end /clone=IMAGE...    44  3e-04
gnl|UG|Mm.29894 vj92a05.s1 Mus musculus cDNA, 5' end /clone=IMA...    40  0.005

>gnl|UG|Mm.28372 C77608 Mus musculus cDNA, 3' end /clone=J0034E02
           /clone_end=3' /gb=C77608 /gi=2517938 /len=551
           Length = 551
           
 Score =  131 bits (66), Expect = 2e-30
 Identities = 73/74 (98%), Positives = 73/74 (98%), Gaps = 1/74 (1%)

                                                                       
Query: 253 ccagagctgaggaccgaacccagggccttgtgcttgctaggcaagcacatctaccactga 312
           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 52  ccagagctgaggaccgaacccagggccttgtgcttgctaggcaagcac-tctaccactga 110

                         
Query: 313 gctaaatccccaac 326
           ||||||||||||||
Sbjct: 111 gctaaatccccaac 124


>gnl|UG|Mm.24396 mb93g07.r1 Mus musculus cDNA, 5' end
           /clone=IMAGE:337020 /clone_end=5' /gb=W20915 /gi=1297840
           /len=363
           Length = 363
           
 Score =  109 bits (55), Expect = 6e-24
 Identities = 68/71 (95%), Positives = 68/71 (95%), Gaps = 1/71 (1%)

                                                                       
Query: 256 gagctgaggaccgaacccagggccttgtgcttgctaggcaagcacatctaccactgagct 315
           ||||||||||||||||||||||||||| ||||||||||||||||| | ||||||||||||
Sbjct: 347 gagctgaggaccgaacccagggccttgggcttgctaggcaagcac-tttaccactgagct 289

                      
Query: 316 aaatccccaac 326
           |||||||||||
Sbjct: 288 aaatccccaac 278


>gnl|UG|Mm.28012 vh59a01.r1 Mus musculus cDNA, 5' end
           /clone=IMAGE:891240 /clone_end=5' /gb=AA510518
           /gi=2248372 /len=553
           Length = 553
           
 Score = 52.0 bits (26), Expect = 1e-06
 Identities = 26/26 (100%), Positives = 26/26 (100%)

                                     
Query: 253 ccagagctgaggaccgaacccagggc 278
           ||||||||||||||||||||||||||
Sbjct: 191 ccagagctgaggaccgaacccagggc 166


>gnl|UG|Mm.177 vp31b10.r1 Mus musculus cDNA, 5' end
           /clone=IMAGE:1078267 /clone_end=5' /gb=AA796791
           /gi=2859746 /len=365
           Length = 365
           
 Score = 44.1 bits (22), Expect = 3e-04
 Identities = 34/38 (89%), Positives = 34/38 (89%)

                                                 
Query: 259 ctgaggaccgaacccagggccttgtgcttgctaggcaa 296
           ||||||||  ||||||||||||||||  ||||||||||
Sbjct: 101 ctgaggactaaacccagggccttgtgaatgctaggcaa 64


>gnl|UG|Mm.29894 vj92a05.s1 Mus musculus cDNA, 5' end
           /clone=IMAGE:944528 /clone_end=5' /gb=AA545112
           /gi=2306186 /len=608
           Length = 608
           
 Score = 40.1 bits (20), Expect = 0.005
 Identities = 39/44 (88%), Positives = 39/44 (88%), Gaps = 1/44 (2%)

                                                       
Query: 273 cagggccttgtgcttgctaggcaagcacatctaccactgagcta 316
           |||||| ||||||||||||   |||||| |||||||||||||||
Sbjct: 89  cagggctttgtgcttgctacaaaagcac-tctaccactgagcta 131


  Database: /ddhome/DDsys/GenDB/UniGeneMm/Mm.seq.uniq
    Posted date:  Feb 17, 1999  1:37 AM
  Number of letters in database: 15,836,343
  Number of sequences in database:  15,275
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7512
Number of Sequences: 15275
Number of extensions: 7512
Number of successful extensions: 1338
Number of sequences better than 10: 56
length of query: 372
length of database: 15836343
effective HSP length: 16
effective length of query: 356
effective length of database: 15591943
effective search space: 5550731708
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 25 (49.6 bits)
S1: 0 ( 0.5 bits)
S2: 15 (30.2 bits)