BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= r00933 (468 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.147166 qc95a09.x1 Homo sapiens cDNA, 3' end /clone=IM... 151 6e-36 gnl|UG|Hs.132432 om47c02.s1 Homo sapiens cDNA, 3' end /clone=IM... 38 0.065 gnl|UG|Hs.113118 zj44b08.s1 Homo sapiens cDNA, 3' end /clone=45... 36 0.26 gnl|UG|Hs.138833 za32b11.r1 Homo sapiens cDNA, 5' end /clone=IM... 34 1.0 >gnl|UG|Hs.147166 qc95a09.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1721944 /clone_end=3' /gb=AI192067 /gi=3743276 /len=369 Length = 369 Score = 151 bits (76), Expect = 6e-36 Identities = 111/121 (91%), Positives = 111/121 (91%), Gaps = 3/121 (2%) Query: 348 tgtactggctagttttgtgtgtcaacttgacacaagctggagttatcacagagaaaggag 407 |||| ||||||||||||||| |||||||||||| ||||||||||||||||||||||||| Sbjct: 342 tgtattggctagttttgtgt--caacttgacaca-gctggagttatcacagagaaaggag 286 Query: 408 cntcagttgaggaaaagcntccatgagacccaactgtaaggcattttctcaactaatgat 467 | ||||||||||||| || ||||||||| ||||||||||||||||||||||| || |||| Sbjct: 285 cttcagttgaggaaatgcctccatgagatccaactgtaaggcattttctcaattagtgat 226 Query: 468 c 468 | Sbjct: 225 c 225 >gnl|UG|Hs.132432 om47c02.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:1544162 /clone_end=3' /gb=AA909676 /gi=3049081 /len=377 Length = 377 Score = 38.2 bits (19), Expect = 0.065 Identities = 19/19 (100%), Positives = 19/19 (100%) Query: 360 ttttgtgtgtcaacttgac 378 ||||||||||||||||||| Sbjct: 193 ttttgtgtgtcaacttgac 211 >gnl|UG|Hs.113118 zj44b08.s1 Homo sapiens cDNA, 3' end /clone=453111 /clone_end=3' /gb=AA700906 /len=465 Length = 465 Score = 36.2 bits (18), Expect = 0.26 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 105 ggggagggagggaggaca 122 |||||||||||||||||| Sbjct: 356 ggggagggagggaggaca 373 >gnl|UG|Hs.138833 za32b11.r1 Homo sapiens cDNA, 5' end /clone=IMAGE:294237 /clone_end=5' /gb=W02015 /gi=1273994 /len=541 Length = 541 Score = 34.2 bits (17), Expect = 1.0 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 157 ttttttaaagtactggg 173 ||||||||||||||||| Sbjct: 54 ttttttaaagtactggg 38 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 11490 Number of Sequences: 62236 Number of extensions: 11490 Number of successful extensions: 3792 Number of sequences better than 10: 48 length of query: 468 length of database: 45520635 effective HSP length: 17 effective length of query: 451 effective length of database: 44462623 effective search space: 20052642973 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 16 (32.2 bits)