BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 978a05 (302 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.161684 zq71h02.s1 Homo sapiens cDNA, 3' end /clone=IM... 50 1e-05 gnl|UG|Hs.104959 zx63e08.s1 Homo sapiens cDNA, 3' end /clone=IM... 44 7e-04 gnl|UG|Hs.130263 qd91f08.x1 Homo sapiens cDNA, 3' end /clone=IM... 42 0.003 gnl|UG|Hs.125848 oo56d03.s1 Homo sapiens cDNA, 3' end /clone=IM... 40 0.010 gnl|UG|Hs.145032 EST49309 Homo sapiens cDNA, 3' end /clone=ATCC... 40 0.010 >gnl|UG|Hs.161684 zq71h02.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:647091 /clone_end=3' /gb=AA205199 /gi=1803207 /len=336 Length = 336 Score = 50.1 bits (25), Expect = 1e-05 Identities = 35/37 (94%), Positives = 35/37 (94%), Gaps = 1/37 (2%) Query: 249 ggtggcatatgcctttaatcccagc-actcaggaggc 284 |||||||| |||||||||||||||| ||||||||||| Sbjct: 152 ggtggcatgtgcctttaatcccagctactcaggaggc 116 >gnl|UG|Hs.104959 zx63e08.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:796166 /clone_end=3' /gb=AA461084 /gi=2186204 /len=472 Length = 472 Score = 44.1 bits (22), Expect = 7e-04 Identities = 28/30 (93%), Positives = 28/30 (93%) Query: 247 gaggtggcatatgcctttaatcccagcact 276 |||||||| ||||||| ||||||||||||| Sbjct: 285 gaggtggcttatgcctgtaatcccagcact 256 >gnl|UG|Hs.130263 qd91f08.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1736871 /clone_end=3' /gb=AI125192 /gi=3593706 /len=364 Length = 364 Score = 42.1 bits (21), Expect = 0.003 Identities = 24/25 (96%), Positives = 24/25 (96%) Query: 249 ggtggcatatgcctttaatcccagc 273 |||||||||||||| |||||||||| Sbjct: 129 ggtggcatatgcctgtaatcccagc 153 >gnl|UG|Hs.125848 oo56d03.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:1570181 /clone_end=3' /gb=AA931565 /gi=3085951 /len=464 Length = 464 Score = 40.1 bits (20), Expect = 0.010 Identities = 20/20 (100%), Positives = 20/20 (100%) Query: 257 atgcctttaatcccagcact 276 |||||||||||||||||||| Sbjct: 264 atgcctttaatcccagcact 245 >gnl|UG|Hs.145032 EST49309 Homo sapiens cDNA, 3' end /clone=ATCC:145063 /clone_end=3' /gb=AA343523 /gi=1995762 /len=369 Length = 369 Score = 40.1 bits (20), Expect = 0.010 Identities = 26/28 (92%), Positives = 26/28 (92%) Query: 249 ggtggcatatgcctttaatcccagcact 276 |||||| ||||||| ||||||||||||| Sbjct: 273 ggtggcttatgcctgtaatcccagcact 246 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 12014 Number of Sequences: 62236 Number of extensions: 12014 Number of successful extensions: 4986 Number of sequences better than 10: 503 length of query: 302 length of database: 45520635 effective HSP length: 17 effective length of query: 285 effective length of database: 44462623 effective search space: 12671847555 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 16 (32.2 bits)