BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 962d04 (227 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.26045 Protein tyrosine phosphatase, receptor type, al... 38 0.030 gnl|UG|Hs.154783 qn14c09.x1 Homo sapiens cDNA, 3' end /clone=IM... 38 0.030 gnl|UG|Hs.131454 Homo sapiens mRNA, chromosome 1 specific trans... 34 0.48 gnl|UG|Hs.116097 EST12993 Homo sapiens cDNA, 3' end /clone=ATCC... 34 0.48 >gnl|UG|Hs.26045 Protein tyrosine phosphatase, receptor type, alpha polypeptide /cds=(695,3103) /gb=M34668 /gi=190738 /len=3615 Length = 3615 Score = 38.2 bits (19), Expect = 0.030 Identities = 19/19 (100%), Positives = 19/19 (100%) Query: 115 ggacaagctggaagaggaa 133 ||||||||||||||||||| Sbjct: 1364 ggacaagctggaagaggaa 1382 >gnl|UG|Hs.154783 qn14c09.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1898224 /clone_end=3' /gb=AI299042 /gi=3958696 /len=422 Length = 422 Score = 38.2 bits (19), Expect = 0.030 Identities = 19/19 (100%), Positives = 19/19 (100%) Query: 160 tatttattatgtatacatt 178 ||||||||||||||||||| Sbjct: 401 tatttattatgtatacatt 419 >gnl|UG|Hs.131454 Homo sapiens mRNA, chromosome 1 specific transcript KIAA0506 /cds=UNKNOWN /gb=AB007975 /gi=3413950 /len=5951 Length = 5951 Score = 34.2 bits (17), Expect = 0.48 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 104 ggttttaagcaggacaa 120 ||||||||||||||||| Sbjct: 1295 ggttttaagcaggacaa 1279 >gnl|UG|Hs.116097 EST12993 Homo sapiens cDNA, 3' end /clone=ATCC:192740 /clone_end=3' /gb=AA303100 /gi=1955452 /len=383 Length = 383 Score = 34.2 bits (17), Expect = 0.48 Identities = 20/21 (95%), Positives = 20/21 (95%) Query: 106 ttttaagcaggacaagctgga 126 ||||| ||||||||||||||| Sbjct: 20 ttttaggcaggacaagctgga 40 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5534 Number of Sequences: 62236 Number of extensions: 5534 Number of successful extensions: 1334 Number of sequences better than 10: 10 length of query: 227 length of database: 45520635 effective HSP length: 17 effective length of query: 210 effective length of database: 44462623 effective search space: 9337150830 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)