BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 957c10 (382 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.84171 Human thrombopoietin receptor (MPL) gene /cds=(... 40 0.013 gnl|UG|Hs.68848 oe61a11.s1 Homo sapiens cDNA, 3' end /clone=IMA... 34 0.83 gnl|UG|Hs.140641 od72a09.s1 Homo sapiens cDNA /clone=IMAGE:1373... 34 0.83 gnl|UG|Hs.138596 yv28d07.s1 Homo sapiens cDNA, 3' end /clone=IM... 34 0.83 gnl|UG|Hs.136293 nc60a08.r1 Homo sapiens cDNA /clone=IMAGE:7456... 34 0.83 >gnl|UG|Hs.84171 Human thrombopoietin receptor (MPL) gene /cds=(45,1952) /gb=U68162 /gi=1546807 /len=3646 Length = 3646 Score = 40.1 bits (20), Expect = 0.013 Identities = 20/20 (100%), Positives = 20/20 (100%) Query: 245 tgagaccctgtctcaaacaa 264 |||||||||||||||||||| Sbjct: 2493 tgagaccctgtctcaaacaa 2474 >gnl|UG|Hs.68848 oe61a11.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:1416092 /clone_end=3' /gb=AA878213 /gi=2987178 /len=519 Length = 519 Score = 34.2 bits (17), Expect = 0.83 Identities = 20/21 (95%), Positives = 20/21 (95%) Query: 199 tcaggagttcaaggccagcct 219 ||||||||||||| ||||||| Sbjct: 211 tcaggagttcaagaccagcct 191 Score = 34.2 bits (17), Expect = 0.83 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 245 tgagaccctgtctcaaa 261 ||||||||||||||||| Sbjct: 19 tgagaccctgtctcaaa 3 >gnl|UG|Hs.140641 od72a09.s1 Homo sapiens cDNA /clone=IMAGE:1373464 /gb=AA847949 /len=242 Length = 242 Score = 34.2 bits (17), Expect = 0.83 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 245 tgagaccctgtctcaaa 261 ||||||||||||||||| Sbjct: 31 tgagaccctgtctcaaa 15 Score = 32.2 bits (16), Expect = 3.3 Identities = 19/20 (95%), Positives = 19/20 (95%) Query: 197 agtcaggagttcaaggccag 216 ||||||||||||||| |||| Sbjct: 235 agtcaggagttcaagaccag 216 >gnl|UG|Hs.138596 yv28d07.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:244045 /clone_end=3' /gb=N38806 /gi=1162013 /len=451 Length = 451 Score = 34.2 bits (17), Expect = 0.83 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 245 tgagaccctgtctcaaa 261 ||||||||||||||||| Sbjct: 24 tgagaccctgtctcaaa 8 Score = 32.2 bits (16), Expect = 3.3 Identities = 19/20 (95%), Positives = 19/20 (95%) Query: 200 caggagttcaaggccagcct 219 |||||||||||| ||||||| Sbjct: 221 caggagttcaagaccagcct 202 >gnl|UG|Hs.136293 nc60a08.r1 Homo sapiens cDNA /clone=IMAGE:745622 /gb=AA420423 /gi=2094320 /len=480 Length = 480 Score = 34.2 bits (17), Expect = 0.83 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 245 tgagaccctgtctcaaa 261 ||||||||||||||||| Sbjct: 20 tgagaccctgtctcaaa 4 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 13294 Number of Sequences: 62236 Number of extensions: 13294 Number of successful extensions: 5270 Number of sequences better than 10: 587 length of query: 382 length of database: 45520635 effective HSP length: 17 effective length of query: 365 effective length of database: 44462623 effective search space: 16228857395 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 16 (32.2 bits)