BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 953c02 (217 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.32959 Human G protein-coupled receptor kinase GRK4 mR... 46 1e-04 gnl|UG|Hs.132140 oy09g03.x1 Homo sapiens cDNA, 3' end /clone=IM... 32 1.8 gnl|UG|Hs.25132 Homo sapiens mRNA for KIAA0470 protein, complet... 32 1.8 gnl|UG|Hs.21281 ou60d03.x1 Homo sapiens cDNA, 3' end /clone=IMA... 32 1.8 gnl|UG|Hs.121073 ai70h06.s1 Homo sapiens cDNA, 3' end /clone=IM... 32 1.8 >gnl|UG|Hs.32959 Human G protein-coupled receptor kinase GRK4 mRNA, alpha splice variant, complete cds /cds=(254,1990) /gb=U33054 /gi=971254 /len=2113 Length = 2113 Score = 46.1 bits (23), Expect = 1e-04 Identities = 35/39 (89%), Positives = 35/39 (89%) Query: 20 tttgcgacagggtgtgtcaccattccctggcagaatgag 58 ||||| || ||||||||| |||| ||||||||||||||| Sbjct: 1761 tttgctaccgggtgtgtctccatcccctggcagaatgag 1799 >gnl|UG|Hs.132140 oy09g03.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1665364 /clone_end=3' /gb=AI041654 /gi=3280848 /len=379 Length = 379 Score = 32.2 bits (16), Expect = 1.8 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 178 aaatttatgcaaagga 193 |||||||||||||||| Sbjct: 192 aaatttatgcaaagga 177 >gnl|UG|Hs.25132 Homo sapiens mRNA for KIAA0470 protein, complete cds /cds=(53,4435) /gb=AB007939 /gi=3413901 /len=6456 Length = 6456 Score = 32.2 bits (16), Expect = 1.8 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 47 tggcagaatgaggtac 62 |||||||||||||||| Sbjct: 2865 tggcagaatgaggtac 2850 >gnl|UG|Hs.21281 ou60d03.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1632197 /clone_end=3' /gb=AI005207 /gi=3214717 /len=572 Length = 572 Score = 32.2 bits (16), Expect = 1.8 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 30 ggtgtgtcaccattcc 45 |||||||||||||||| Sbjct: 122 ggtgtgtcaccattcc 107 >gnl|UG|Hs.121073 ai70h06.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:1376219 /clone_end=3' /gb=AA844734 /gi=2931185 /len=498 Length = 498 Score = 32.2 bits (16), Expect = 1.8 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 87 atgctagtgctagttt 102 |||||||||||||||| Sbjct: 99 atgctagtgctagttt 114 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2562 Number of Sequences: 62236 Number of extensions: 2562 Number of successful extensions: 635 Number of sequences better than 10: 5 length of query: 217 length of database: 45520635 effective HSP length: 17 effective length of query: 200 effective length of database: 44462623 effective search space: 8892524600 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)