BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 944e04 (645 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.148621 qr33b03.x1 Homo sapiens cDNA, 3' end /clone=IM... 38 0.091 gnl|UG|Hs.125529 am27b06.s1 Homo sapiens cDNA, 3' end /clone=IM... 36 0.36 gnl|UG|Hs.90449 Human clone 23908 mRNA sequence /cds=UNKNOWN /g... 34 1.4 gnl|UG|Hs.94042 zo86d04.s1 Homo sapiens cDNA, 3' end /clone=IMA... 34 1.4 gnl|UG|Hs.97053 EST80310 Homo sapiens cDNA, 3' end /clone=ATCC:... 34 1.4 >gnl|UG|Hs.148621 qr33b03.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1942637 /clone_end=3' /gb=AI203006 /gi=3755612 /len=310 Length = 310 Score = 38.2 bits (19), Expect = 0.091 Identities = 19/19 (100%), Positives = 19/19 (100%) Query: 115 tttattttaaaaaggcatt 133 ||||||||||||||||||| Sbjct: 204 tttattttaaaaaggcatt 222 >gnl|UG|Hs.125529 am27b06.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:1468019 /clone_end=3' /gb=AA883986 /gi=2993516 /len=675 Length = 675 Score = 36.2 bits (18), Expect = 0.36 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 108 aaaacaatttattttaaa 125 |||||||||||||||||| Sbjct: 387 aaaacaatttattttaaa 370 >gnl|UG|Hs.90449 Human clone 23908 mRNA sequence /cds=UNKNOWN /gb=U79290 /gi=1710270 /len=1813 Length = 1813 Score = 34.2 bits (17), Expect = 1.4 Identities = 20/21 (95%), Positives = 20/21 (95%) Query: 249 atgggctttttaaaattcaaa 269 |||||||||||||| |||||| Sbjct: 214 atgggctttttaaacttcaaa 194 >gnl|UG|Hs.94042 zo86d04.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:593767 /clone_end=3' /gb=AA166966 /gi=1745342 /len=598 Length = 598 Score = 34.2 bits (17), Expect = 1.4 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 590 tcattgtaatagacaca 606 ||||||||||||||||| Sbjct: 517 tcattgtaatagacaca 501 >gnl|UG|Hs.97053 EST80310 Homo sapiens cDNA, 3' end /clone=ATCC:173675 /clone_end=3' /gb=AA368976 /gi=2021296 /len=210 Length = 210 Score = 34.2 bits (17), Expect = 1.4 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 107 caaaacaatttatttta 123 ||||||||||||||||| Sbjct: 4 caaaacaatttatttta 20 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 17179 Number of Sequences: 62236 Number of extensions: 17179 Number of successful extensions: 1428 Number of sequences better than 10: 11 length of query: 645 length of database: 45520635 effective HSP length: 18 effective length of query: 627 effective length of database: 44400387 effective search space: 27839042649 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 16 (32.2 bits)