BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 940b08 (262 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.127007 Homo sapiens two pore domain K+ channel (TASK-... 100 1e-20 gnl|UG|Hs.114646 qc18f02.x1 Homo sapiens cDNA, 3' end /clone=IM... 34 0.55 gnl|UG|Hs.129918 Homo sapiens mRNA for LAK-1, complete cds /cds... 34 0.55 >gnl|UG|Hs.127007 Homo sapiens two pore domain K+ channel (TASK-2) mRNA, complete cds /cds=(339,1838) /gb=AF084830 /gi=3925426 /len=3477 Length = 3477 Score = 99.6 bits (50), Expect = 1e-20 Identities = 80/90 (88%), Positives = 80/90 (88%) Query: 170 tatggtaatgtggctcccaagaccccagctgggcgcctcttctgtgtcttctatggcctg 229 ||||| |||||||||||||||||||| || || |||||||||||||| |||||||| || Sbjct: 640 tatggcaatgtggctcccaagacccccgccggtcgcctcttctgtgttttctatggtctc 699 Query: 230 ttcggggtgccactgtgcctgacatggatc 259 ||||||||||| || |||||||| |||||| Sbjct: 700 ttcggggtgccgctctgcctgacgtggatc 729 >gnl|UG|Hs.114646 qc18f02.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1709979 /clone_end=3' /gb=AI131414 /gi=3601430 /len=560 Length = 560 Score = 34.2 bits (17), Expect = 0.55 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 206 ctcttctgtgtcttcta 222 ||||||||||||||||| Sbjct: 341 ctcttctgtgtcttcta 325 >gnl|UG|Hs.129918 Homo sapiens mRNA for LAK-1, complete cds /cds=(200,1150) /gb=AB005754 /gi=2804243 /len=1557 Length = 1557 Score = 34.2 bits (17), Expect = 0.55 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 204 gcctcttctgtgtcttc 220 ||||||||||||||||| Sbjct: 597 gcctcttctgtgtcttc 613 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6748 Number of Sequences: 62236 Number of extensions: 6748 Number of successful extensions: 1794 Number of sequences better than 10: 16 length of query: 262 length of database: 45520635 effective HSP length: 17 effective length of query: 245 effective length of database: 44462623 effective search space: 10893342635 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)