BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 846f07 (390 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.91146 yv53f11.r1 Homo sapiens cDNA, 5' end /clone=IMA... 40 0.014 gnl|UG|Hs.62929 ox79c08.x1 Homo sapiens cDNA, 3' end /clone=IMA... 38 0.054 gnl|UG|Hs.91626 Homo sapiens clone B18 unknown mRNA /cds=UNKNOW... 34 0.84 gnl|UG|Hs.149088 qh78e08.x1 Homo sapiens cDNA, 3' end /clone=IM... 32 3.3 gnl|UG|Hs.139032 yn59f10.s1 Homo sapiens cDNA, 3' end /clone=IM... 32 3.3 >gnl|UG|Hs.91146 yv53f11.r1 Homo sapiens cDNA, 5' end /clone=IMAGE:246477 /clone_end=5' /gb=N73230 /gi=1230334 /len=417 Length = 417 Score = 40.1 bits (20), Expect = 0.014 Identities = 30/32 (93%), Positives = 30/32 (93%), Gaps = 1/32 (3%) Query: 159 ctcagcctcccaagcttgctgggatgacaggc 190 ||||||||||||| || ||||||||||||||| Sbjct: 287 ctcagcctcccaatct-gctgggatgacaggc 257 >gnl|UG|Hs.62929 ox79c08.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1662542 /clone_end=3' /gb=AI083557 /gi=3421980 /len=419 Length = 419 Score = 38.2 bits (19), Expect = 0.054 Identities = 19/19 (100%), Positives = 19/19 (100%) Query: 247 ctgttttgttctcaaagat 265 ||||||||||||||||||| Sbjct: 378 ctgttttgttctcaaagat 360 >gnl|UG|Hs.91626 Homo sapiens clone B18 unknown mRNA /cds=UNKNOWN /gb=AF052497 /gi=3090894 /len=3288 Length = 3288 Score = 32.2 bits (16), Expect = 3.3 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 175 tgctgggatgacaggc 190 |||||||||||||||| Sbjct: 1114 tgctgggatgacaggc 1099 Score = 34.2 bits (17), Expect = 0.84 Identities = 30/33 (90%), Positives = 30/33 (90%), Gaps = 1/33 (3%) Query: 158 tctcagcctcccaagcttgctgggatgacaggc 190 ||||||||||||||| | |||||||| |||||| Sbjct: 1265 tctcagcctcccaag-tagctgggattacaggc 1234 >gnl|UG|Hs.149088 qh78e08.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1850822 /clone_end=3' /gb=AI243920 /gi=3839317 /len=383 Length = 383 Score = 32.2 bits (16), Expect = 3.3 Identities = 29/32 (90%), Positives = 29/32 (90%), Gaps = 1/32 (3%) Query: 159 ctcagcctcccaagcttgctgggatgacaggc 190 ||||||||||||| |||||||||||||||| Sbjct: 324 ctcagcctcccaa-agtgctgggatgacaggc 294 >gnl|UG|Hs.139032 yn59f10.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:172747 /clone_end=3' /gb=H19684 /gi=888379 /len=448 Length = 448 Score = 32.2 bits (16), Expect = 3.3 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 175 tgctgggatgacaggc 190 |||||||||||||||| Sbjct: 248 tgctgggatgacaggc 263 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 12365 Number of Sequences: 62236 Number of extensions: 12365 Number of successful extensions: 4445 Number of sequences better than 10: 64 length of query: 390 length of database: 45520635 effective HSP length: 17 effective length of query: 373 effective length of database: 44462623 effective search space: 16584558379 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 16 (32.2 bits)