BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 810a12 (337 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.105478 Human mRNA for KIAA0361 gene, KIAA0361 protein... 38 0.046 gnl|UG|Hs.144049 ox64d02.s1 Homo sapiens cDNA, 3' end /clone=IM... 36 0.18 gnl|UG|Hs.134173 oy95h03.x1 Homo sapiens cDNA, 3' end /clone=IM... 36 0.18 gnl|UG|Hs.72307 qn31g05.x1 Homo sapiens cDNA, 3' end /clone=IMA... 36 0.18 gnl|UG|Hs.6241 Human P13-kinase associated p85 mRNA sequence /c... 36 0.18 >gnl|UG|Hs.105478 Human mRNA for KIAA0361 gene, KIAA0361 protein /cds=(0,4116) /gb=AB002359 /gi=2224662 /len=5338 Length = 5338 Score = 38.2 bits (19), Expect = 0.046 Identities = 19/19 (100%), Positives = 19/19 (100%) Query: 52 aaaacatccctcagagcca 70 ||||||||||||||||||| Sbjct: 4487 aaaacatccctcagagcca 4469 >gnl|UG|Hs.144049 ox64d02.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:1661091 /clone_end=3' /gb=AI142862 /gi=3659221 /len=495 Length = 495 Score = 36.2 bits (18), Expect = 0.18 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 38 cctcacagtgttggaaaa 55 |||||||||||||||||| Sbjct: 455 cctcacagtgttggaaaa 472 >gnl|UG|Hs.134173 oy95h03.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1673621 /clone_end=3' /gb=AI079523 /gi=3415774 /len=462 Length = 462 Score = 36.2 bits (18), Expect = 0.18 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 15 ttttttcttctccttcag 32 |||||||||||||||||| Sbjct: 80 ttttttcttctccttcag 97 >gnl|UG|Hs.72307 qn31g05.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1899896 /clone_end=3' /gb=AI282097 /gi=3920330 /len=462 Length = 462 Score = 36.2 bits (18), Expect = 0.18 Identities = 20/21 (95%), Positives = 20/21 (95%) Query: 172 tggggaaagggangccagaaa 192 |||||||||||| |||||||| Sbjct: 441 tggggaaagggaggccagaaa 421 >gnl|UG|Hs.6241 Human P13-kinase associated p85 mRNA sequence /cds=UNKNOWN /gb=M61906 /gi=189424 /len=3372 Length = 3372 Score = 36.2 bits (18), Expect = 0.18 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 77 ttctcagcagccagctct 94 |||||||||||||||||| Sbjct: 865 ttctcagcagccagctct 882 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 10372 Number of Sequences: 62236 Number of extensions: 10372 Number of successful extensions: 2810 Number of sequences better than 10: 32 length of query: 337 length of database: 45520635 effective HSP length: 17 effective length of query: 320 effective length of database: 44462623 effective search space: 14228039360 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 16 (32.2 bits)