BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 777e12 (357 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.23881 Homo sapiens cytokeratin 2 mRNA, complete cds /... 32 3.0 gnl|UG|Hs.66727 Human ATP-dependent inwardly rectifying potassi... 32 3.0 gnl|UG|Hs.163455 qh87b04.x1 Homo sapiens cDNA, 3' end /clone=IM... 32 3.0 gnl|UG|Hs.17735 zw84a06.s1 Homo sapiens cDNA, 3' end /clone=IMA... 32 3.0 >gnl|UG|Hs.23881 Homo sapiens cytokeratin 2 mRNA, complete cds /cds=(31,1947) /gb=M99063 /gi=181389 /len=2513 Length = 2513 Score = 32.2 bits (16), Expect = 3.0 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 264 gaaaccctggctcctg 279 |||||||||||||||| Sbjct: 82 gaaaccctggctcctg 67 >gnl|UG|Hs.66727 Human ATP-dependent inwardly rectifying potassium channel Kir4.1 mRNA, complete cds /cds=(226,1365) /gb=U52155 /gi=1518529 /len=2211 Length = 2211 Score = 32.2 bits (16), Expect = 3.0 Identities = 19/20 (95%), Positives = 19/20 (95%) Query: 256 cacagtgggaaaccctggct 275 |||||||| ||||||||||| Sbjct: 1909 cacagtggcaaaccctggct 1890 >gnl|UG|Hs.163455 qh87b04.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1853935 /clone_end=3' /gb=AI242202 /gi=3837599 /len=404 Length = 404 Score = 32.2 bits (16), Expect = 3.0 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 324 ctgaattaattaggga 339 |||||||||||||||| Sbjct: 297 ctgaattaattaggga 282 >gnl|UG|Hs.17735 zw84a06.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:783634 /clone_end=3' /gb=AA446548 /gi=2159213 /len=441 Length = 441 Score = 32.2 bits (16), Expect = 3.0 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 229 gtctccaggtagaaaa 244 |||||||||||||||| Sbjct: 208 gtctccaggtagaaaa 223 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5034 Number of Sequences: 62236 Number of extensions: 5034 Number of successful extensions: 1296 Number of sequences better than 10: 4 length of query: 357 length of database: 45520635 effective HSP length: 17 effective length of query: 340 effective length of database: 44462623 effective search space: 15117291820 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 16 (32.2 bits)