BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 755c09 (278 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.73737 Human alternative splicing factor mRNA, complet... 36 0.15 gnl|UG|Hs.155836 qf43c09.x1 Homo sapiens cDNA, 3' end /clone=IM... 34 0.59 gnl|UG|Hs.129841 Homo sapiens MEK kinase 1 (MEKK1) mRNA, partia... 32 2.3 gnl|UG|Hs.112172 Homo sapiens mRNA for membrane glycoprotein gp... 32 2.3 gnl|UG|Hs.74566 Human mRNA for dihydropyrimidinase related prot... 32 2.3 >gnl|UG|Hs.73737 Human alternative splicing factor mRNA, complete cds /cds=UNKNOWN /gb=M72709 /gi=179073 /len=1717 Length = 1717 Score = 36.2 bits (18), Expect = 0.15 Identities = 20/21 (95%), Positives = 20/21 (95%) Query: 60 aagacacatganaagcaagat 80 ||||||||||| ||||||||| Sbjct: 1396 aagacacatgaaaagcaagat 1376 >gnl|UG|Hs.155836 qf43c09.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1752784 /clone_end=3' /gb=AI149815 /gi=3678284 /len=492 Length = 492 Score = 34.2 bits (17), Expect = 0.59 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 179 taaatcccttaaagaaa 195 ||||||||||||||||| Sbjct: 17 taaatcccttaaagaaa 1 >gnl|UG|Hs.129841 Homo sapiens MEK kinase 1 (MEKK1) mRNA, partial cds /cds=(0,4487) /gb=AF042838 /gi=2815887 /len=4693 Length = 4693 Score = 32.2 bits (16), Expect = 2.3 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 138 aatacaagtaaacagg 153 |||||||||||||||| Sbjct: 3154 aatacaagtaaacagg 3169 >gnl|UG|Hs.112172 Homo sapiens mRNA for membrane glycoprotein gp36 /cds=(132,620) /gb=AJ225022 /gi=2960073 /len=768 Length = 768 Score = 32.2 bits (16), Expect = 2.3 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 73 agcaagattctgagct 88 |||||||||||||||| Sbjct: 95 agcaagattctgagct 80 >gnl|UG|Hs.74566 Human mRNA for dihydropyrimidinase related protein-3, complete cds /cds=(110,1822) /gb=D78014 /gi=1330241 /len=5047 Length = 5047 Score = 32.2 bits (16), Expect = 2.3 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 81 tctgagctaaaatcct 96 |||||||||||||||| Sbjct: 2809 tctgagctaaaatcct 2794 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4364 Number of Sequences: 62236 Number of extensions: 4364 Number of successful extensions: 1132 Number of sequences better than 10: 7 length of query: 278 length of database: 45520635 effective HSP length: 17 effective length of query: 261 effective length of database: 44462623 effective search space: 11604744603 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)