BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 731d11 (242 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.64016 Plasma protein S /cds=(244,2198) /gb=M14338 /g... 78 4e-14 gnl|UG|Hs.114483 ab78h12.s1 Homo sapiens cDNA, 3' end /clone=IM... 38 0.033 gnl|UG|Hs.157350 qw27c08.x1 Homo sapiens cDNA, 3' end /clone=IM... 32 2.0 >gnl|UG|Hs.64016 Plasma protein S /cds=(244,2198) /gb=M14338 /gi=190448 /len=3329 Length = 3329 Score = 77.8 bits (39), Expect = 4e-14 Identities = 57/63 (90%), Positives = 57/63 (90%) Query: 173 ttttcagctgaatttgattttcggacatatgattcagagggcatcatactgtatgcagaa 232 |||||||| ||||||||||| ||||||||||||||||| ||| | |||||||| |||||| Sbjct: 1135 ttttcagcagaatttgatttccggacatatgattcagaaggcgtgatactgtacgcagaa 1194 Query: 233 tct 235 ||| Sbjct: 1195 tct 1197 >gnl|UG|Hs.114483 ab78h12.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:853127 /clone_end=3' /gb=AA668363 /gi=2629862 /len=443 Length = 443 Score = 38.2 bits (19), Expect = 0.033 Identities = 19/19 (100%), Positives = 19/19 (100%) Query: 2 atcctttaaatttcttttt 20 ||||||||||||||||||| Sbjct: 70 atcctttaaatttcttttt 88 >gnl|UG|Hs.157350 qw27c08.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1992302 /clone_end=3' /gb=AI367233 /gi=4136978 /len=516 Length = 516 Score = 32.2 bits (16), Expect = 2.0 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 6 tttaaatttctttttt 21 |||||||||||||||| Sbjct: 272 tttaaatttctttttt 287 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5420 Number of Sequences: 62236 Number of extensions: 5420 Number of successful extensions: 1496 Number of sequences better than 10: 10 length of query: 242 length of database: 45520635 effective HSP length: 17 effective length of query: 225 effective length of database: 44462623 effective search space: 10004090175 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)