BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 726h10 (246 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.85769 Human acidic 82 kDa protein mRNA, complete cds ... 76 2e-13 gnl|UG|Hs.91400 Homo sapiens mRNA for KIAA0288 gene, complete c... 34 0.52 gnl|UG|Hs.856 Human immune interferon (IFN-gamma) gene /cds=(12... 34 0.52 gnl|UG|Hs.112434 Human BRCA2 region, mRNA sequence CG016 /cds=U... 32 2.0 gnl|UG|Hs.21295 yf75c03.s1 Homo sapiens cDNA, 3' end /clone=IMA... 32 2.0 >gnl|UG|Hs.85769 Human acidic 82 kDa protein mRNA, complete cds /cds=(24,2234) /gb=U15552 /gi=558457 /len=2366 Length = 2366 Score = 75.8 bits (38), Expect = 2e-13 Identities = 97/114 (85%), Positives = 97/114 (85%), Gaps = 2/114 (1%) Query: 130 tttctgaagttgatgcttggactcactatatggcggtacacaatagttatttttcaaaat 189 |||||||||||||| ||| || ||||||||||| || ||||| | ||| ||||||||||| Sbjct: 1917 tttctgaagttgatactttgattcactatatggtggaacacagtggtt-tttttcaaaat 1859 Query: 190 ccggtataatgacagctttttgtagaagttcgttttccttttatctccttgatc 243 | ||| ||||||| ||||| || ||||| || |||| ||||| ||||||||||| Sbjct: 1858 caggtgtaatgacggctttctgcagaagctcatttttctttt-tctccttgatc 1806 >gnl|UG|Hs.91400 Homo sapiens mRNA for KIAA0288 gene, complete cds /cds=(1143,4046) /gb=AB006626 /gi=2564323 /len=8459 Length = 8459 Score = 34.2 bits (17), Expect = 0.52 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 223 tttccttttatctcctt 239 ||||||||||||||||| Sbjct: 8138 tttccttttatctcctt 8154 >gnl|UG|Hs.856 Human immune interferon (IFN-gamma) gene /cds=(128,628) /gb=V00536 /gi=32675 /len=1214 Length = 1214 Score = 34.2 bits (17), Expect = 0.52 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 30 tcaggagatttcatgcc 46 ||||||||||||||||| Sbjct: 1087 tcaggagatttcatgcc 1103 >gnl|UG|Hs.112434 Human BRCA2 region, mRNA sequence CG016 /cds=UNKNOWN /gb=U50529 /gi=1531600 /len=2812 Length = 2812 Score = 32.2 bits (16), Expect = 2.0 Identities = 19/20 (95%), Positives = 19/20 (95%) Query: 170 caatagttatttttcaaaat 189 ||||||||||||||| |||| Sbjct: 2632 caatagttatttttccaaat 2651 >gnl|UG|Hs.21295 yf75c03.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:28107 /clone_end=3' /gb=R40781 /gi=823032 /len=415 Length = 415 Score = 32.2 bits (16), Expect = 2.0 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 51 caaccattgctgtctg 66 |||||||||||||||| Sbjct: 137 caaccattgctgtctg 122 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6149 Number of Sequences: 62236 Number of extensions: 6149 Number of successful extensions: 1749 Number of sequences better than 10: 13 length of query: 246 length of database: 45520635 effective HSP length: 17 effective length of query: 229 effective length of database: 44462623 effective search space: 10181940667 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)