BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 305e08 (376 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.124773 zp51d08.r1 Homo sapiens cDNA, 5' end /clone=IM... 34 0.81 gnl|UG|Hs.160055 ou28a02.x1 Homo sapiens cDNA, 3' end /clone=IM... 34 0.81 gnl|UG|Hs.146439 qc04b06.x1 Homo sapiens cDNA, 3' end /clone=IM... 34 0.81 gnl|UG|Hs.62273 zo31a01.s1 Homo sapiens cDNA, 3' end /clone=IMA... 34 0.81 gnl|UG|Hs.44690 Homo sapiens clone 24739 mRNA sequence /cds=UNK... 32 3.2 >gnl|UG|Hs.124773 zp51d08.r1 Homo sapiens cDNA, 5' end /clone=IMAGE:612975 /clone_end=5' /gb=AA182909 /gi=1766168 /len=400 Length = 400 Score = 34.2 bits (17), Expect = 0.81 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 231 cagagatcagaaacttt 247 ||||||||||||||||| Sbjct: 321 cagagatcagaaacttt 337 >gnl|UG|Hs.160055 ou28a02.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1627562 /clone_end=3' /gb=AI017156 /gi=3231492 /len=412 Length = 412 Score = 34.2 bits (17), Expect = 0.81 Identities = 20/21 (95%), Positives = 20/21 (95%) Query: 244 cttttaggagttggttctctc 264 ||||||||||||| ||||||| Sbjct: 411 cttttaggagttgattctctc 391 >gnl|UG|Hs.146439 qc04b06.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1708595 /clone_end=3' /gb=AI127342 /gi=3595856 /len=399 Length = 399 Score = 34.2 bits (17), Expect = 0.81 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 239 agaaacttttaggagtt 255 ||||||||||||||||| Sbjct: 163 agaaacttttaggagtt 179 >gnl|UG|Hs.62273 zo31a01.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:588456 /clone_end=3' /gb=AA143745 /gi=1713158 /len=649 Length = 649 Score = 34.2 bits (17), Expect = 0.81 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 79 agtaacctttatgaaac 95 ||||||||||||||||| Sbjct: 412 agtaacctttatgaaac 396 >gnl|UG|Hs.44690 Homo sapiens clone 24739 mRNA sequence /cds=UNKNOWN /gb=AF070571 /gi=3387940 /len=2639 Length = 2639 Score = 32.2 bits (16), Expect = 3.2 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 79 agtaacctttatgaaa 94 |||||||||||||||| Sbjct: 2577 agtaacctttatgaaa 2562 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5348 Number of Sequences: 62236 Number of extensions: 5348 Number of successful extensions: 1436 Number of sequences better than 10: 8 length of query: 376 length of database: 45520635 effective HSP length: 17 effective length of query: 359 effective length of database: 44462623 effective search space: 15962081657 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 16 (32.2 bits)