BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 301b08 (316 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.121990 zj04h06.s1 Homo sapiens cDNA, 3' end /clone=44... 46 2e-04 gnl|UG|Hs.160548 ql63a08.x1 Homo sapiens cDNA, 3' end /clone=IM... 42 0.003 gnl|UG|Hs.5997 al07h10.s1 Homo sapiens cDNA, 3' end /clone=IMAG... 36 0.17 gnl|UG|Hs.40700 ys67d01.r1 Homo sapiens cDNA, 5' end /clone=IMA... 36 0.17 gnl|UG|Hs.65238 Homo sapiens mRNA for KIAA0661 protein, complet... 36 0.17 >gnl|UG|Hs.121990 zj04h06.s1 Homo sapiens cDNA, 3' end /clone=449339 /clone_end=3' /gb=AA777920 /len=456 Length = 456 Score = 46.1 bits (23), Expect = 2e-04 Identities = 31/34 (91%), Positives = 31/34 (91%) Query: 279 tctttatttacntttcaaatgttactccctttcc 312 ||||||||||| |||||||||||| |||||||| Sbjct: 29 tctttatttacatttcaaatgttatcccctttcc 62 >gnl|UG|Hs.160548 ql63a08.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1876982 /clone_end=3' /gb=AI275380 /gi=3897654 /len=333 Length = 333 Score = 42.1 bits (21), Expect = 0.003 Identities = 21/21 (100%), Positives = 21/21 (100%) Query: 30 atttaggtgctggagatggag 50 ||||||||||||||||||||| Sbjct: 278 atttaggtgctggagatggag 298 >gnl|UG|Hs.5997 al07h10.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:1425187 /clone_end=3' /gb=AA897088 /gi=3033708 /len=640 Length = 640 Score = 36.2 bits (18), Expect = 0.17 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 103 ttctgaaacaatgatctg 120 |||||||||||||||||| Sbjct: 338 ttctgaaacaatgatctg 321 >gnl|UG|Hs.40700 ys67d01.r1 Homo sapiens cDNA, 5' end /clone=IMAGE:219841 /clone_end=5' /gb=H85170 /gi=1063979 /len=462 Length = 462 Score = 36.2 bits (18), Expect = 0.17 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 93 ccactgaactttctgaaa 110 |||||||||||||||||| Sbjct: 244 ccactgaactttctgaaa 261 >gnl|UG|Hs.65238 Homo sapiens mRNA for KIAA0661 protein, complete cds /cds=(92,3097) /gb=AB014561 /gi=3327135 /len=4199 Length = 4199 Score = 36.2 bits (18), Expect = 0.17 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 34 aggtgctggagatggaga 51 |||||||||||||||||| Sbjct: 904 aggtgctggagatggaga 921 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 9828 Number of Sequences: 62236 Number of extensions: 9828 Number of successful extensions: 2668 Number of sequences better than 10: 22 length of query: 316 length of database: 45520635 effective HSP length: 17 effective length of query: 299 effective length of database: 44462623 effective search space: 13294324277 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 16 (32.2 bits)