BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 196e09 (446 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.87023 zr78c08.r1 Homo sapiens cDNA, 5' end /clone=IMA... 36 0.25 gnl|UG|Hs.3244 Human Gps2 (GPS2) mRNA, complete cds /cds=(90,10... 36 0.25 gnl|UG|Hs.162199 nf93d12.s1 Homo sapiens cDNA, 3' end /clone=IM... 36 0.25 gnl|UG|Hs.334 Human guanine nucleotide regulatory protein (tim1... 36 0.25 gnl|UG|Hs.133867 qh02d03.x1 Homo sapiens cDNA, 3' end /clone=IM... 36 0.25 >gnl|UG|Hs.87023 zr78c08.r1 Homo sapiens cDNA, 5' end /clone=IMAGE:669518 /clone_end=5' /gb=AA234799 /gi=1859292 /len=406 Length = 406 Score = 36.2 bits (18), Expect = 0.25 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 210 tgaaggaactgaagaaaa 227 |||||||||||||||||| Sbjct: 22 tgaaggaactgaagaaaa 39 >gnl|UG|Hs.3244 Human Gps2 (GPS2) mRNA, complete cds /cds=(90,1073) /gb=U28963 /gi=1049069 /len=1168 Length = 1168 Score = 36.2 bits (18), Expect = 0.25 Identities = 20/21 (95%), Positives = 20/21 (95%) Query: 362 gagatggaagagagaatntca 382 ||||||||||||||||| ||| Sbjct: 253 gagatggaagagagaatgtca 273 >gnl|UG|Hs.162199 nf93d12.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:927479 /clone_end=3' /gb=AA535279 /gi=2279532 /len=265 Length = 265 Score = 36.2 bits (18), Expect = 0.25 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 179 aaagaaatagaggaaaat 196 |||||||||||||||||| Sbjct: 90 aaagaaatagaggaaaat 73 >gnl|UG|Hs.334 Human guanine nucleotide regulatory protein (tim1) mRNA, complete cds /cds=(93,1652) /gb=U02082 /gi=484101 /len=2226 Length = 2226 Score = 36.2 bits (18), Expect = 0.25 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 387 tagaagataccttagagg 404 |||||||||||||||||| Sbjct: 2109 tagaagataccttagagg 2092 >gnl|UG|Hs.133867 qh02d03.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1843493 /clone_end=3' /gb=AI222067 /gi=3804270 /len=409 Length = 409 Score = 36.2 bits (18), Expect = 0.25 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 95 atacacatatttagaaat 112 |||||||||||||||||| Sbjct: 204 atacacatatttagaaat 221 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 15218 Number of Sequences: 62236 Number of extensions: 15218 Number of successful extensions: 4754 Number of sequences better than 10: 44 length of query: 446 length of database: 45520635 effective HSP length: 17 effective length of query: 429 effective length of database: 44462623 effective search space: 19074465267 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 16 (32.2 bits)