BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 180b07 (258 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.121990 zj04h06.s1 Homo sapiens cDNA, 3' end /clone=44... 34 0.55 gnl|UG|Hs.79090 Homo sapiens mRNA for CRM1 protein, complete cd... 34 0.55 gnl|UG|Hs.101359 Human mRNA for KIAA0386 gene, complete cds /cd... 32 2.2 gnl|UG|Hs.12537 Homo sapiens clone 23808 mRNA sequence /cds=UNK... 32 2.2 gnl|UG|Hs.63314 zk80a06.s1 Homo sapiens cDNA, 3' end /clone=IMA... 32 2.2 >gnl|UG|Hs.121990 zj04h06.s1 Homo sapiens cDNA, 3' end /clone=449339 /clone_end=3' /gb=AA777920 /len=456 Length = 456 Score = 34.2 bits (17), Expect = 0.55 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 238 tgacaaatacagaagtg 254 ||||||||||||||||| Sbjct: 435 tgacaaatacagaagtg 419 >gnl|UG|Hs.79090 Homo sapiens mRNA for CRM1 protein, complete cds /cds=(18,3233) /gb=D89729 /gi=2626839 /len=4088 Length = 4088 Score = 34.2 bits (17), Expect = 0.55 Identities = 20/21 (95%), Positives = 20/21 (95%) Query: 205 atatagctgtctcctgagagg 225 |||||||||||||||| |||| Sbjct: 1245 atatagctgtctcctgggagg 1225 >gnl|UG|Hs.101359 Human mRNA for KIAA0386 gene, complete cds /cds=(177,3383) /gb=AB002384 /gi=2224712 /len=5471 Length = 5471 Score = 32.2 bits (16), Expect = 2.2 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 242 aaatacagaagtgaat 257 |||||||||||||||| Sbjct: 5373 aaatacagaagtgaat 5358 >gnl|UG|Hs.12537 Homo sapiens clone 23808 mRNA sequence /cds=UNKNOWN /gb=AF038192 /gi=2795912 /len=1187 Length = 1187 Score = 32.2 bits (16), Expect = 2.2 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 62 tagcctgccccacctg 77 |||||||||||||||| Sbjct: 900 tagcctgccccacctg 915 >gnl|UG|Hs.63314 zk80a06.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:489106 /clone_end=3' /gb=AA056538 /gi=1548878 /len=565 Length = 565 Score = 32.2 bits (16), Expect = 2.2 Identities = 19/20 (95%), Positives = 19/20 (95%) Query: 147 agccgccaaaactagacaat 166 ||||||||||| |||||||| Sbjct: 65 agccgccaaaaatagacaat 84 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5487 Number of Sequences: 62236 Number of extensions: 5487 Number of successful extensions: 1535 Number of sequences better than 10: 9 length of query: 258 length of database: 45520635 effective HSP length: 17 effective length of query: 241 effective length of database: 44462623 effective search space: 10715492143 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)