BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 103d10 (370 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.86858 Human p70 ribosomal S6 kinase alpha-I mRNA, com... 80 2e-14 gnl|UG|Hs.93909 Homo sapiens rod photoreceptor CNG-channel beta... 36 0.20 gnl|UG|Hs.25391 yj92g12.s1 Homo sapiens cDNA, 3' end /clone=IMA... 34 0.80 gnl|UG|Hs.5943 qg23c09.x1 Homo sapiens cDNA, 3' end /clone=IMAG... 34 0.80 gnl|UG|Hs.7811 Human translation initiation factor 3 47 kDa sub... 34 0.80 >gnl|UG|Hs.86858 Human p70 ribosomal S6 kinase alpha-I mRNA, complete cds /cds=(27,1604) /gb=M60724 /gi=189507 /len=2346 Length = 2346 Score = 79.8 bits (40), Expect = 2e-14 Identities = 46/48 (95%), Positives = 46/48 (95%) Query: 1 aatttgcctccctacctcacacaagaagctcgagatctgcttaaaaag 48 ||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 958 aatttgcctccctacctcacacaagaagccagagatctgcttaaaaag 1005 >gnl|UG|Hs.93909 Homo sapiens rod photoreceptor CNG-channel beta subunit (RCNC2) mRNA, complete cds /cds=(70,3807) /gb=AF042498 /gi=2921582 /len=4382 Length = 4382 Score = 36.2 bits (18), Expect = 0.20 Identities = 21/22 (95%), Positives = 21/22 (95%) Query: 44 aaaaggtagggctcttaaatga 65 ||||||||||||||| |||||| Sbjct: 4073 aaaaggtagggctctcaaatga 4052 >gnl|UG|Hs.25391 yj92g12.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:156262 /clone_end=3' /gb=R73418 /gi=847450 /len=487 Length = 487 Score = 34.2 bits (17), Expect = 0.80 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 308 cctcctgagtcctgggg 324 ||||||||||||||||| Sbjct: 237 cctcctgagtcctgggg 221 >gnl|UG|Hs.5943 qg23c09.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1761904 /clone_end=3' /gb=AI222558 /gi=3804761 /len=641 Length = 641 Score = 34.2 bits (17), Expect = 0.80 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 245 ggttgtttgttttgttt 261 ||||||||||||||||| Sbjct: 479 ggttgtttgttttgttt 463 >gnl|UG|Hs.7811 Human translation initiation factor 3 47 kDa subunit mRNA, complete cds /cds=(6,1079) /gb=U94855 /gi=2055430 /len=1231 Length = 1231 Score = 34.2 bits (17), Expect = 0.80 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 312 ctgagtcctggggttaa 328 ||||||||||||||||| Sbjct: 1132 ctgagtcctggggttaa 1116 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 8197 Number of Sequences: 62236 Number of extensions: 8197 Number of successful extensions: 2599 Number of sequences better than 10: 16 length of query: 370 length of database: 45520635 effective HSP length: 17 effective length of query: 353 effective length of database: 44462623 effective search space: 15695305919 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 16 (32.2 bits)