BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 094b01 (514 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.118512 Integrin, alpha V (vitronectin receptor, alpha... 115 4e-25 gnl|UG|Hs.131078 ot73a04.s1 Homo sapiens cDNA, 3' end /clone=IM... 36 0.28 gnl|UG|Hs.152940 ny79a07.s1 Homo sapiens cDNA /clone=IMAGE:1284... 36 0.28 gnl|UG|Hs.52899 yp57g03.r1 Homo sapiens cDNA, 5' end /clone=IMA... 34 1.1 gnl|UG|Hs.92317 Human Ste20-like kinase (MST2) mRNA, complete c... 34 1.1 >gnl|UG|Hs.118512 Integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51) /cds=(41,3187) /gb=M14648 /gi=340306 /len=5717 Length = 5717 Score = 115 bits (58), Expect = 4e-25 Identities = 109/126 (86%), Positives = 109/126 (86%) Query: 1 gatccacaggcttgaattcggtgccatctcaaatcctgcaggggcagtgggccgctcaga 60 |||| ||||||||||| | || |||||||||||||| | ||||||||||| |||| | Sbjct: 1267 gatcaacaggcttgaacgcagtcccatctcaaatccttgaagggcagtgggctgctcgaa 1326 Query: 61 gcatgcccccaagctttggctattcaatgaagggagctacagatgtagatagaaatggat 120 ||||||| ||||||||||||||||||||||| ||||| |||||| |||| | |||||||| Sbjct: 1327 gcatgccaccaagctttggctattcaatgaaaggagccacagatatagacaaaaatggat 1386 Query: 121 atccag 126 |||||| Sbjct: 1387 atccag 1392 >gnl|UG|Hs.131078 ot73a04.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:1622382 /clone_end=3' /gb=AI016540 /gi=3230876 /len=455 Length = 455 Score = 36.2 bits (18), Expect = 0.28 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 338 gagctagtatttttatga 355 |||||||||||||||||| Sbjct: 210 gagctagtatttttatga 193 >gnl|UG|Hs.152940 ny79a07.s1 Homo sapiens cDNA /clone=IMAGE:1284468 /gb=AA744532 /gi=2783296 /len=568 Length = 568 Score = 36.2 bits (18), Expect = 0.28 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 326 tttgtttttaaggagcta 343 |||||||||||||||||| Sbjct: 266 tttgtttttaaggagcta 249 >gnl|UG|Hs.52899 yp57g03.r1 Homo sapiens cDNA, 5' end /clone=IMAGE:191572 /clone_end=5' /gb=H37880 /gi=907379 /len=572 Length = 572 Score = 34.2 bits (17), Expect = 1.1 Identities = 23/25 (92%), Positives = 23/25 (92%) Query: 185 ttcttttcttgcccaccaccccatt 209 ||||||||||| ||||| ||||||| Sbjct: 271 ttcttttcttggccacctccccatt 295 >gnl|UG|Hs.92317 Human Ste20-like kinase (MST2) mRNA, complete cds /cds=(138,1613) /gb=U26424 /gi=1203795 /len=2820 Length = 2820 Score = 34.2 bits (17), Expect = 1.1 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 159 tttttcagtccccaagg 175 ||||||||||||||||| Sbjct: 2642 tttttcagtccccaagg 2626 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 15031 Number of Sequences: 62236 Number of extensions: 15031 Number of successful extensions: 1159 Number of sequences better than 10: 39 length of query: 514 length of database: 45520635 effective HSP length: 17 effective length of query: 497 effective length of database: 44462623 effective search space: 22097923631 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 16 (32.2 bits)