BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 068a10 (289 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.40866 Homo sapiens potassium channel homolog (KCNQ3) ... 137 6e-32 gnl|UG|Hs.24553 qb77b03.x1 Homo sapiens cDNA, 3' end /clone=IMA... 36 0.16 gnl|UG|Hs.153837 Myeloid cell nuclear differentiation antigen /... 34 0.62 gnl|UG|Hs.145601 qh49e08.x1 Homo sapiens cDNA, 3' end /clone=IM... 34 0.62 gnl|UG|Hs.40098 om52a06.s1 Homo sapiens cDNA, 3' end /clone=IMA... 34 0.62 >gnl|UG|Hs.40866 Homo sapiens potassium channel homolog (KCNQ3) mRNA, partial cds /cds=(0,2477) /gb=AF033347 /gi=2801449 /len=2730 Length = 2730 Score = 137 bits (69), Expect = 6e-32 Identities = 84/89 (94%), Positives = 84/89 (94%) Query: 174 acctgtctttcaacttttacaaacttccccatcatgctttggtcttcagtttctgatgtg 233 ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 1745 acctgtctttcaacttttacaaacttccccatcatgctttggtcttcgatttctgatgtg 1686 Query: 234 gctgccctggctacatatggttcattcct 262 | || ||||||||||||||||||||||| Sbjct: 1685 gatggtctggctacatatggttcattcct 1657 >gnl|UG|Hs.24553 qb77b03.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1706093 /clone_end=3' /gb=AI150687 /gi=3679156 /len=528 Length = 528 Score = 36.2 bits (18), Expect = 0.16 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 228 gatgtggctgccctggct 245 |||||||||||||||||| Sbjct: 334 gatgtggctgccctggct 351 >gnl|UG|Hs.153837 Myeloid cell nuclear differentiation antigen /cds=(200,1423) /gb=M81750 /gi=895928 /len=1670 Length = 1670 Score = 34.2 bits (17), Expect = 0.62 Identities = 23/25 (92%), Positives = 23/25 (92%) Query: 263 aaagaaaagtcaaaagttcctaaga 287 ||||| |||||||||||| |||||| Sbjct: 450 aaagagaagtcaaaagttgctaaga 474 >gnl|UG|Hs.145601 qh49e08.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1848038 /clone_end=3' /gb=AI263166 /gi=3871369 /len=411 Length = 411 Score = 34.2 bits (17), Expect = 0.62 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 165 gaagggcttacctgtct 181 ||||||||||||||||| Sbjct: 348 gaagggcttacctgtct 332 >gnl|UG|Hs.40098 om52a06.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:1550770 /clone_end=3' /gb=AA912445 /gi=3051837 /len=705 Length = 705 Score = 34.2 bits (17), Expect = 0.62 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 85 aaatctaaaatgaaaag 101 ||||||||||||||||| Sbjct: 328 aaatctaaaatgaaaag 312 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 10166 Number of Sequences: 62236 Number of extensions: 10166 Number of successful extensions: 2940 Number of sequences better than 10: 22 length of query: 289 length of database: 45520635 effective HSP length: 17 effective length of query: 272 effective length of database: 44462623 effective search space: 12093833456 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)