BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 066e10 (427 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.161069 yv16h09.s1 Homo sapiens cDNA, 3' end /clone=IM... 50 2e-05 gnl|UG|Hs.130339 oz31c12.x1 Homo sapiens cDNA, 3' end /clone=IM... 48 6e-05 gnl|UG|Hs.163652 yw45a08.s1 Homo sapiens cDNA, 3' end /clone=IM... 48 6e-05 gnl|UG|Hs.155259 yw45h03.s1 Homo sapiens cDNA, 3' end /clone=IM... 46 2e-04 gnl|UG|Hs.35718 Homo sapiens sterol 12-alpha hydroxylase CYP8B1... 46 2e-04 >gnl|UG|Hs.161069 yv16h09.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:242945 /clone_end=3' /gb=H93727 /gi=1100055 /len=417 Length = 417 Score = 50.1 bits (25), Expect = 2e-05 Identities = 28/29 (96%), Positives = 28/29 (96%) Query: 8 ctgggctacagagtgagaatctgtctcaa 36 |||||| |||||||||||||||||||||| Sbjct: 42 ctgggcgacagagtgagaatctgtctcaa 14 >gnl|UG|Hs.130339 oz31c12.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1676950 /clone_end=3' /gb=AI076624 /gi=3405802 /len=583 Length = 583 Score = 48.1 bits (24), Expect = 6e-05 Identities = 30/32 (93%), Positives = 30/32 (93%) Query: 9 tgggctacagagtgagaatctgtctcaaaaca 40 ||||||||||||||||| || ||||||||||| Sbjct: 357 tgggctacagagtgagactccgtctcaaaaca 388 >gnl|UG|Hs.163652 yw45a08.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:255158 /clone_end=3' /gb=N22023 /gi=1128157 /len=352 Length = 352 Score = 48.1 bits (24), Expect = 6e-05 Identities = 33/36 (91%), Positives = 33/36 (91%) Query: 3 tcagtctgggctacagagtgagaatctgtctcaaaa 38 |||| |||||| ||||||||||| |||||||||||| Sbjct: 169 tcagcctgggcgacagagtgagactctgtctcaaaa 204 >gnl|UG|Hs.155259 yw45h03.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:255221 /clone_end=3' /gb=N22058 /gi=1128192 /len=440 Length = 440 Score = 46.1 bits (23), Expect = 2e-04 Identities = 29/31 (93%), Positives = 29/31 (93%) Query: 8 ctgggctacagagtgagaatctgtctcaaaa 38 |||||| ||||||||||| |||||||||||| Sbjct: 42 ctgggcgacagagtgagactctgtctcaaaa 12 >gnl|UG|Hs.35718 Homo sapiens sterol 12-alpha hydroxylase CYP8B1 (Cyp8b1) mRNA, partial cds /cds=(0,1389) /gb=AF090318 /gi=3703083 /len=3509 Length = 3509 Score = 46.1 bits (23), Expect = 2e-04 Identities = 29/31 (93%), Positives = 29/31 (93%) Query: 8 ctgggctacagagtgagaatctgtctcaaaa 38 |||||| ||||||||||| |||||||||||| Sbjct: 2380 ctgggcaacagagtgagactctgtctcaaaa 2350 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 10626 Number of Sequences: 62236 Number of extensions: 10626 Number of successful extensions: 3434 Number of sequences better than 10: 323 length of query: 427 length of database: 45520635 effective HSP length: 17 effective length of query: 410 effective length of database: 44462623 effective search space: 18229675430 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 16 (32.2 bits)