BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 065e09 (189 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.121931 zj05f02.s1 Homo sapiens cDNA, 3' end /clone=44... 76 1e-13 gnl|UG|Hs.127254 qd87h09.x1 Homo sapiens cDNA, 3' end /clone=IM... 40 0.006 gnl|UG|Hs.2795 Human mRNA for lactate dehydrogenase-A (LDH-A, E... 40 0.006 gnl|UG|Hs.50905 Homo sapiens mRNA for STK9 protein /cds=(221,33... 34 0.39 gnl|UG|Hs.157588 qx15c04.x1 Homo sapiens cDNA, 3' end /clone=IM... 32 1.5 >gnl|UG|Hs.121931 zj05f02.s1 Homo sapiens cDNA, 3' end /clone=449403 /clone_end=3' /gb=AA777875 /len=311 Length = 311 Score = 75.8 bits (38), Expect = 1e-13 Identities = 45/46 (97%), Positives = 45/46 (97%), Gaps = 1/46 (2%) Query: 144 ttggcatgacacttgagtggttggttccatcatccatatgcagatc 189 ||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 17 ttggcatgacacttg-gtggttggttccatcatccatatgcagatc 61 >gnl|UG|Hs.127254 qd87h09.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1736513 /clone_end=3' /gb=AI125255 /gi=3593769 /len=452 Length = 452 Score = 40.1 bits (20), Expect = 0.006 Identities = 20/20 (100%), Positives = 20/20 (100%) Query: 117 ctgttcaaggtttatttggt 136 |||||||||||||||||||| Sbjct: 21 ctgttcaaggtttatttggt 40 >gnl|UG|Hs.2795 Human mRNA for lactate dehydrogenase-A (LDH-A, EC 1.1.1.27) /cds=(97,1095) /gb=X02152 /gi=34312 /len=1661 Length = 1661 Score = 40.1 bits (20), Expect = 0.006 Identities = 38/44 (86%), Positives = 38/44 (86%) Query: 115 cactgttcaaggtttatttggtgttttccttggcatgacacttg 158 |||||||||||||||||| || ||||| |||| || ||||||| Sbjct: 1661 cactgttcaaggtttattgggggttttagttggtataacacttg 1618 >gnl|UG|Hs.50905 Homo sapiens mRNA for STK9 protein /cds=(221,3313) /gb=Y15057 /gi=3559924 /len=3399 Length = 3399 Score = 34.2 bits (17), Expect = 0.39 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 156 ttgagtggttggttcca 172 ||||||||||||||||| Sbjct: 2472 ttgagtggttggttcca 2456 >gnl|UG|Hs.157588 qx15c04.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:2001414 /clone_end=3' /gb=AI356996 /gi=4108617 /len=342 Length = 342 Score = 32.2 bits (16), Expect = 1.5 Identities = 16/16 (100%), Positives = 16/16 (100%) Query: 162 ggttggttccatcatc 177 |||||||||||||||| Sbjct: 301 ggttggttccatcatc 316 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3779 Number of Sequences: 62236 Number of extensions: 3779 Number of successful extensions: 1048 Number of sequences better than 10: 11 length of query: 189 length of database: 45520635 effective HSP length: 17 effective length of query: 172 effective length of database: 44462623 effective search space: 7647571156 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)