BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 02715 (752 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.25296 yh95h05.s1 Homo sapiens cDNA, 3' end /clone=IMA... 36 0.42 gnl|UG|Hs.137587 Homo sapiens evolutionarily related interleuki... 36 0.42 gnl|UG|Hs.31720 Homo sapiens mRNA for KIAA0698 protein, complet... 34 1.7 >gnl|UG|Hs.25296 yh95h05.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:137529 /clone_end=3' /gb=R38342 /gi=795798 /len=480 Length = 480 Score = 36.2 bits (18), Expect = 0.42 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 616 tgaaaacatattatttct 633 |||||||||||||||||| Sbjct: 186 tgaaaacatattatttct 169 >gnl|UG|Hs.137587 Homo sapiens evolutionarily related interleukin-1beta converting enzyme mRNA, complete cds /cds=(62,1195) /gb=AF078533 /gi=3386522 /len=2043 Length = 2043 Score = 36.2 bits (18), Expect = 0.42 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 609 attaaagtgaaaacatat 626 |||||||||||||||||| Sbjct: 1285 attaaagtgaaaacatat 1302 >gnl|UG|Hs.31720 Homo sapiens mRNA for KIAA0698 protein, complete cds /cds=(838,3513) /gb=AB014598 /gi=3327209 /len=4227 Length = 4227 Score = 34.2 bits (17), Expect = 1.7 Identities = 20/21 (95%), Positives = 20/21 (95%) Query: 612 aaagtgaaaacatattatttc 632 ||||||||| ||||||||||| Sbjct: 3697 aaagtgaaatcatattatttc 3677 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 12479 Number of Sequences: 62236 Number of extensions: 12479 Number of successful extensions: 974 Number of sequences better than 10: 4 length of query: 752 length of database: 45520635 effective HSP length: 18 effective length of query: 734 effective length of database: 44400387 effective search space: 32589884058 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 16 (32.2 bits)