BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 01895 (638 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.148048 yh70c12.s1 Homo sapiens cDNA, 3' end /clone=IM... 36 0.35 gnl|UG|Hs.134851 oo22f05.x1 Homo sapiens cDNA, 3' end /clone=IM... 36 0.35 gnl|UG|Hs.147863 qg25d03.x1 Homo sapiens cDNA, 3' end /clone=IM... 36 0.35 gnl|UG|Hs.159963 on07g06.s1 Homo sapiens cDNA, 3' end /clone=IM... 34 1.4 gnl|UG|Hs.109544 zd90h09.s1 Homo sapiens cDNA, 3' end /clone=IM... 34 1.4 >gnl|UG|Hs.148048 yh70c12.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:135094 /clone_end=3' /gb=R31426 /gi=787269 /len=432 Length = 432 Score = 36.2 bits (18), Expect = 0.35 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 557 attagggaaatgaaaaca 574 |||||||||||||||||| Sbjct: 96 attagggaaatgaaaaca 113 >gnl|UG|Hs.134851 oo22f05.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1566945 /clone_end=3' /gb=AI091355 /gi=3430414 /len=492 Length = 492 Score = 36.2 bits (18), Expect = 0.35 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 557 attagggaaatgaaaaca 574 |||||||||||||||||| Sbjct: 95 attagggaaatgaaaaca 112 >gnl|UG|Hs.147863 qg25d03.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1762085 /clone_end=3' /gb=AI222681 /gi=3804884 /len=267 Length = 267 Score = 36.2 bits (18), Expect = 0.35 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 413 ttattagtttataaattt 430 |||||||||||||||||| Sbjct: 20 ttattagtttataaattt 37 >gnl|UG|Hs.159963 on07g06.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:1556026 /clone_end=3' /gb=AA977701 /gi=3155147 /len=453 Length = 453 Score = 34.2 bits (17), Expect = 1.4 Identities = 17/17 (100%), Positives = 17/17 (100%) Query: 265 cattttctgtttttaga 281 ||||||||||||||||| Sbjct: 230 cattttctgtttttaga 246 >gnl|UG|Hs.109544 zd90h09.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:356801 /clone_end=3' /gb=W84529 /gi=1395641 /len=617 Length = 617 Score = 34.2 bits (17), Expect = 1.4 Identities = 20/21 (95%), Positives = 20/21 (95%) Query: 270 tctgtttttagatattttgga 290 |||||||||||||||| |||| Sbjct: 109 tctgtttttagatattgtgga 89 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 12595 Number of Sequences: 62236 Number of extensions: 12595 Number of successful extensions: 959 Number of sequences better than 10: 8 length of query: 638 length of database: 45520635 effective HSP length: 18 effective length of query: 620 effective length of database: 44400387 effective search space: 27528239940 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 16 (32.2 bits)