BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 01241 (286 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.156585 qo35h11.x1 Homo sapiens cDNA, 3' end /clone=IM... 52 3e-06 gnl|UG|Hs.158693 ta35d03.x1 Homo sapiens cDNA, 3' end /clone=IM... 50 1e-05 gnl|UG|Hs.157631 qv13g09.x1 Homo sapiens cDNA, 3' end /clone=IM... 48 4e-05 gnl|UG|Hs.163917 EST176050 Homo sapiens cDNA, 5' end /clone=ATC... 48 4e-05 gnl|UG|Hs.132607 os76e12.s1 Homo sapiens cDNA, 3' end /clone=IM... 48 4e-05 >gnl|UG|Hs.156585 qo35h11.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1910565 /clone_end=3' /gb=AI342724 /gi=4079930 /len=401 Length = 401 Score = 52.0 bits (26), Expect = 3e-06 Identities = 48/54 (88%), Positives = 48/54 (88%), Gaps = 1/54 (1%) Query: 1 gatccacctgcctcagactccc-aagtgctggaattaaagccctgtgccaccat 53 |||||||||||||||| ||||| |||||||||||||| || | || |||||||| Sbjct: 44 gatccacctgcctcagcctccccaagtgctggaattacaggcatgagccaccat 97 >gnl|UG|Hs.158693 ta35d03.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:2046053 /clone_end=3' /gb=AI371998 /gi=4150751 /len=453 Length = 453 Score = 50.1 bits (25), Expect = 1e-05 Identities = 35/37 (94%), Positives = 35/37 (94%), Gaps = 1/37 (2%) Query: 1 gatccacctgcctcagactccc-aagtgctggaatta 36 |||||||||||||||| ||||| |||||||||||||| Sbjct: 59 gatccacctgcctcagcctcccaaagtgctggaatta 95 >gnl|UG|Hs.157631 qv13g09.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1981504 /clone_end=3' /gb=AI357899 /gi=4109520 /len=644 Length = 644 Score = 48.1 bits (24), Expect = 4e-05 Identities = 30/32 (93%), Positives = 30/32 (93%) Query: 1 gatccacctgcctcagactcccaagtgctgga 32 |||||||||||||||| |||| |||||||||| Sbjct: 583 gatccacctgcctcagcctccaaagtgctgga 552 >gnl|UG|Hs.163917 EST176050 Homo sapiens cDNA, 5' end /clone=ATCC:128540 /clone_end=5' /gb=AA305047 /gi=1957373 /len=500 Length = 500 Score = 48.1 bits (24), Expect = 4e-05 Identities = 34/36 (94%), Positives = 34/36 (94%), Gaps = 1/36 (2%) Query: 2 atccacctgcctcagactccc-aagtgctggaatta 36 ||||||||||||||| ||||| |||||||||||||| Sbjct: 236 atccacctgcctcagcctcccaaagtgctggaatta 201 >gnl|UG|Hs.132607 os76e12.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:1611310 /clone_end=3' /gb=AI032155 /gi=3250367 /len=434 Length = 434 Score = 48.1 bits (24), Expect = 4e-05 Identities = 24/24 (100%), Positives = 24/24 (100%) Query: 1 gatccacctgcctcagactcccaa 24 |||||||||||||||||||||||| Sbjct: 36 gatccacctgcctcagactcccaa 59 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 7366 Number of Sequences: 62236 Number of extensions: 7366 Number of successful extensions: 2335 Number of sequences better than 10: 202 length of query: 286 length of database: 45520635 effective HSP length: 17 effective length of query: 269 effective length of database: 44462623 effective search space: 11960445587 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 15 (30.2 bits)