BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 00041 (507 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,236 sequences; 45,520,635 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.159127 te35h06.x1 Homo sapiens cDNA, 3' end /clone=IM... 44 0.001 gnl|UG|Hs.158271 ae79g12.s1 Homo sapiens cDNA, 3' end /clone=97... 44 0.001 gnl|UG|Hs.23094 Human Line-1 repeat mRNA with 2 open reading fr... 40 0.018 gnl|UG|Hs.152629 Human mRNA for KIAA0179 gene, partial cds /cds... 36 0.28 gnl|UG|Hs.6079 Homo sapiens mRNA for KIAA0598 protein, complete... 32 4.4 >gnl|UG|Hs.159127 te35h06.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:2088731 /clone_end=3' /gb=AI384013 /len=838 Length = 838 Score = 44.1 bits (22), Expect = 0.001 Identities = 24/25 (96%), Positives = 24/25 (96%) Query: 454 actttgctgaagttgtttatcagct 478 ||| ||||||||||||||||||||| Sbjct: 406 actntgctgaagttgtttatcagct 430 >gnl|UG|Hs.158271 ae79g12.s1 Homo sapiens cDNA, 3' end /clone=970438 /clone_end=3' /gb=AA776660 /len=425 Length = 425 Score = 44.1 bits (22), Expect = 0.001 Identities = 25/26 (96%), Positives = 25/26 (96%) Query: 454 actttgctgaagttgtttatcagctt 479 ||||||||||||||| |||||||||| Sbjct: 372 actttgctgaagttgcttatcagctt 397 >gnl|UG|Hs.23094 Human Line-1 repeat mRNA with 2 open reading frames /cds=(876,1892) /gb=M19503 /gi=337662 /len=5976 Length = 5976 Score = 40.1 bits (20), Expect = 0.018 Identities = 23/24 (95%), Positives = 23/24 (95%) Query: 456 tttgctgaagttgtttatcagctt 479 ||||||||||||| |||||||||| Sbjct: 4137 tttgctgaagttgcttatcagctt 4114 >gnl|UG|Hs.152629 Human mRNA for KIAA0179 gene, partial cds /cds=(0,2288) /gb=D80001 /gi=1136417 /len=4994 Length = 4994 Score = 36.2 bits (18), Expect = 0.28 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 400 tcttttgtgtagaggaag 417 |||||||||||||||||| Sbjct: 1163 tcttttgtgtagaggaag 1180 >gnl|UG|Hs.6079 Homo sapiens mRNA for KIAA0598 protein, complete cds /cds=(581,2266) /gb=AB011170 /gi=3043719 /len=4712 Length = 4712 Score = 32.2 bits (16), Expect = 4.4 Identities = 19/20 (95%), Positives = 19/20 (95%) Query: 341 atattatttggtctattatg 360 |||||||||||| ||||||| Sbjct: 4325 atattatttggtttattatg 4344 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Feb 27, 1999 1:26 AM Number of letters in database: 45,520,635 Number of sequences in database: 62,236 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 12407 Number of Sequences: 62236 Number of extensions: 12407 Number of successful extensions: 3452 Number of sequences better than 10: 32 length of query: 507 length of database: 45520635 effective HSP length: 17 effective length of query: 490 effective length of database: 44462623 effective search space: 21786685270 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 16 (32.2 bits)